Incidental Mutation 'R7508:Slc9a5'
ID585922
Institutional Source Beutler Lab
Gene Symbol Slc9a5
Ensembl Gene ENSMUSG00000014786
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 5
SynonymsLOC277973
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105348843-105369881 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 105363253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073149]
Predicted Effect probably null
Transcript: ENSMUST00000073149
SMART Domains Protein: ENSMUSP00000072893
Gene: ENSMUSG00000014786

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 39 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 458 9.8e-89 PFAM
low complexity region 705 723 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Slc9a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Slc9a5 APN 8 105349443 missense probably damaging 0.99
IGL02339:Slc9a5 APN 8 105358459 missense probably damaging 1.00
IGL03220:Slc9a5 APN 8 105368020 missense probably benign 0.09
P0026:Slc9a5 UTSW 8 105355291 missense probably damaging 1.00
R0680:Slc9a5 UTSW 8 105355907 missense probably null 1.00
R0990:Slc9a5 UTSW 8 105359446 missense probably damaging 1.00
R1440:Slc9a5 UTSW 8 105355153 missense possibly damaging 0.91
R1625:Slc9a5 UTSW 8 105368123 missense possibly damaging 0.88
R1737:Slc9a5 UTSW 8 105368134 missense probably damaging 1.00
R4169:Slc9a5 UTSW 8 105357400 missense possibly damaging 0.77
R4209:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4210:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4211:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4345:Slc9a5 UTSW 8 105349455 missense probably benign
R4665:Slc9a5 UTSW 8 105368128 missense probably damaging 1.00
R5058:Slc9a5 UTSW 8 105355858 missense probably benign 0.03
R5553:Slc9a5 UTSW 8 105357040 missense probably damaging 1.00
R5574:Slc9a5 UTSW 8 105364691 missense probably benign 0.12
R5631:Slc9a5 UTSW 8 105349509 missense possibly damaging 0.73
R5645:Slc9a5 UTSW 8 105357013 missense probably benign 0.00
R5856:Slc9a5 UTSW 8 105357165 missense possibly damaging 0.58
R5907:Slc9a5 UTSW 8 105357175 critical splice donor site probably null
R6481:Slc9a5 UTSW 8 105358393 nonsense probably null
R6799:Slc9a5 UTSW 8 105363968 missense possibly damaging 0.84
R6834:Slc9a5 UTSW 8 105364684 missense probably benign 0.00
R6938:Slc9a5 UTSW 8 105353432 missense probably damaging 1.00
R7064:Slc9a5 UTSW 8 105349446 missense possibly damaging 0.91
R7095:Slc9a5 UTSW 8 105357636 missense probably benign 0.16
R7152:Slc9a5 UTSW 8 105368393 missense probably benign 0.03
R7303:Slc9a5 UTSW 8 105356713 missense probably damaging 0.99
R7583:Slc9a5 UTSW 8 105363272 missense possibly damaging 0.62
R7895:Slc9a5 UTSW 8 105363366 missense probably damaging 1.00
R8077:Slc9a5 UTSW 8 105359380 missense probably damaging 1.00
R8217:Slc9a5 UTSW 8 105363324 missense probably damaging 0.97
X0058:Slc9a5 UTSW 8 105355305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTCTCTGGCTATATTCC -3'
(R):5'- TTGTTACCAGCCTATAGCCG -3'

Sequencing Primer
(F):5'- CAGGGTCTCTGGCTATATTCCATTTG -3'
(R):5'- TGTTACCAGCCTATAGCCGTAAAGG -3'
Posted On2019-10-18