Incidental Mutation 'R7508:Dna2'
ID585923
Institutional Source Beutler Lab
Gene Symbol Dna2
Ensembl Gene ENSMUSG00000036875
Gene NameDNA replication helicase/nuclease 2
SynonymsE130315B21Rik, Dna2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62947026-62974185 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 62971993 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092462] [ENSMUST00000131422]
Predicted Effect probably benign
Transcript: ENSMUST00000092462
SMART Domains Protein: ENSMUSP00000090119
Gene: ENSMUSG00000036875

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 68 284 4.7e-75 PFAM
Pfam:PDDEXK_1 125 404 4.3e-13 PFAM
Pfam:AAA_11 626 799 6.7e-42 PFAM
Pfam:AAA_30 626 848 1.1e-15 PFAM
Pfam:AAA_19 633 709 5.7e-9 PFAM
Pfam:AAA_12 806 944 4.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131422
SMART Domains Protein: ENSMUSP00000115750
Gene: ENSMUSG00000036875

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 72 283 8.2e-65 PFAM
Pfam:PDDEXK_1 125 404 3e-11 PFAM
Pfam:AAA_11 626 732 7.8e-17 PFAM
Pfam:AAA_30 626 848 1.3e-15 PFAM
Pfam:AAA_19 633 709 6.2e-9 PFAM
Pfam:AAA_11 722 799 1.2e-21 PFAM
Pfam:AAA_12 806 1020 5.3e-57 PFAM
Meta Mutation Damage Score 0.9351 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA2/NAM7 helicase family. The encoded protein is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability. Mutations in this gene are associated with autosomal dominant progressive external ophthalmoplegia-6 (PEOA6) and Seckel syndrome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E7.5. Mice heterozygous for the allele exhibit shortened telomeres, chromosome segregation errors and increased tumor incidence associated with aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Dna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dna2 APN 10 62966443 missense probably damaging 1.00
IGL00972:Dna2 APN 10 62950823 missense probably benign 0.13
IGL01511:Dna2 APN 10 62955314 missense possibly damaging 0.69
IGL01600:Dna2 APN 10 62950806 missense probably damaging 0.96
IGL02016:Dna2 APN 10 62960412 missense probably benign 0.00
IGL02049:Dna2 APN 10 62957036 missense probably damaging 0.99
IGL02069:Dna2 APN 10 62958994 missense probably benign 0.00
IGL02438:Dna2 APN 10 62957062 missense possibly damaging 0.92
IGL02743:Dna2 APN 10 62957042 missense possibly damaging 0.90
IGL02800:Dna2 APN 10 62961725 critical splice donor site probably null
IGL02936:Dna2 APN 10 62957100 missense probably damaging 1.00
supercoiled UTSW 10 62971993 splice site probably null
R0308:Dna2 UTSW 10 62956974 missense probably damaging 0.98
R0528:Dna2 UTSW 10 62958131 missense probably benign 0.00
R0669:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R0697:Dna2 UTSW 10 62949341 missense probably benign 0.01
R0831:Dna2 UTSW 10 62959329 nonsense probably null
R0839:Dna2 UTSW 10 62969782 missense probably damaging 1.00
R0991:Dna2 UTSW 10 62949187 missense probably benign 0.08
R0992:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1054:Dna2 UTSW 10 62963823 missense possibly damaging 0.84
R1082:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1084:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1184:Dna2 UTSW 10 62959198 missense probably benign 0.00
R1193:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1196:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1226:Dna2 UTSW 10 62960424 missense possibly damaging 0.88
R1561:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1562:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1566:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1568:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1598:Dna2 UTSW 10 62961657 missense probably damaging 0.99
R1768:Dna2 UTSW 10 62957084 missense probably benign 0.01
R2075:Dna2 UTSW 10 62969822 missense probably benign 0.20
R3125:Dna2 UTSW 10 62949202 missense possibly damaging 0.66
R3763:Dna2 UTSW 10 62966797 missense probably damaging 1.00
R4059:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R5002:Dna2 UTSW 10 62950842 missense probably damaging 1.00
R5160:Dna2 UTSW 10 62947154 missense probably benign
R5567:Dna2 UTSW 10 62966673 missense possibly damaging 0.89
R5775:Dna2 UTSW 10 62949242 missense possibly damaging 0.94
R5984:Dna2 UTSW 10 62962506 critical splice donor site probably null
R6604:Dna2 UTSW 10 62967743 critical splice donor site probably null
R6702:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6703:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6812:Dna2 UTSW 10 62959341 missense probably benign 0.18
R6820:Dna2 UTSW 10 62964904 missense possibly damaging 0.93
R6919:Dna2 UTSW 10 62957003 missense probably damaging 1.00
R7029:Dna2 UTSW 10 62963994 missense probably damaging 1.00
R7082:Dna2 UTSW 10 62954317 missense possibly damaging 0.71
R7513:Dna2 UTSW 10 62971968 missense probably benign 0.00
R7605:Dna2 UTSW 10 62960275 missense probably benign 0.02
R7742:Dna2 UTSW 10 62973294 missense probably benign 0.31
R7868:Dna2 UTSW 10 62969864 missense probably benign 0.00
R7983:Dna2 UTSW 10 62955394 missense probably benign 0.04
R8508:Dna2 UTSW 10 62950894 missense probably damaging 1.00
RF007:Dna2 UTSW 10 62966695 missense probably damaging 0.99
Z1177:Dna2 UTSW 10 62962424 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAAGTTTCCTTTTGCCCCAG -3'
(R):5'- ATCCCTGCATACGCTAGTCC -3'

Sequencing Primer
(F):5'- CTTTTGCCCCAGCTCGG -3'
(R):5'- TGCATACGCTAGTCCCAGATG -3'
Posted On2019-10-18