Incidental Mutation 'R7513:Dip2b'
ID 585930
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 045586-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R7513 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 100105629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably null
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100203
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,765,771 (GRCm39) W694* probably null Het
Accs T C 2: 93,670,437 (GRCm39) N256S possibly damaging Het
Agmo C T 12: 37,294,352 (GRCm39) T100I probably benign Het
Alox8 T C 11: 69,078,670 (GRCm39) D341G probably benign Het
Apol7c T A 15: 77,409,911 (GRCm39) E345V possibly damaging Het
Arl5a A G 2: 52,302,157 (GRCm39) F86L possibly damaging Het
AU040320 A G 4: 126,686,057 (GRCm39) E211G probably benign Het
B020011L13Rik T A 1: 117,729,149 (GRCm39) C219S probably damaging Het
Btaf1 T A 19: 36,955,803 (GRCm39) L579Q probably benign Het
Cd84 T A 1: 171,712,185 (GRCm39) V267E probably benign Het
Cdcp3 G A 7: 130,873,800 (GRCm39) G1709R unknown Het
Clec11a T C 7: 43,955,780 (GRCm39) E89G probably benign Het
Csrnp2 C A 15: 100,380,297 (GRCm39) E331D probably benign Het
Cyp2d12 C A 15: 82,442,621 (GRCm39) H355N probably benign Het
Ddx24 C A 12: 103,385,365 (GRCm39) G413* probably null Het
Dhx38 G A 8: 110,287,221 (GRCm39) P249L probably benign Het
Dip2a A T 10: 76,149,069 (GRCm39) M233K probably benign Het
Dmbt1 T C 7: 130,692,242 (GRCm39) S1003P unknown Het
Dna2 A G 10: 62,807,747 (GRCm39) D1033G probably benign Het
Dnah5 T C 15: 28,370,561 (GRCm39) S2834P probably benign Het
Dnah7b T G 1: 46,163,506 (GRCm39) S437A probably benign Het
Eif5 A T 12: 111,506,686 (GRCm39) I93F probably damaging Het
Fbxo47 A G 11: 97,747,055 (GRCm39) F337S probably damaging Het
Helz T C 11: 107,546,941 (GRCm39) I1086T probably damaging Het
Ifi208 A T 1: 173,523,220 (GRCm39) R497* probably null Het
Igfn1 T G 1: 135,887,705 (GRCm39) D2453A probably damaging Het
Ighg2c A T 12: 113,252,471 (GRCm39) L27Q Het
Jak1 C T 4: 101,048,848 (GRCm39) C10Y probably damaging Het
Kif7 T A 7: 79,360,776 (GRCm39) N200Y possibly damaging Het
Ktn1 G C 14: 47,901,541 (GRCm39) A100P possibly damaging Het
Lrsam1 T C 2: 32,843,497 (GRCm39) D136G probably benign Het
Man2c1 T C 9: 57,046,683 (GRCm39) L648P probably benign Het
Mki67 T C 7: 135,294,952 (GRCm39) I3116V probably benign Het
Mmp10 A T 9: 7,508,128 (GRCm39) D418V probably damaging Het
Mrpl24 A T 3: 87,829,734 (GRCm39) T107S probably benign Het
Mycbpap T A 11: 94,394,382 (GRCm39) D296V probably damaging Het
Mycn C A 12: 12,989,743 (GRCm39) A218S probably benign Het
Myo1f G T 17: 33,794,788 (GRCm39) W9C probably damaging Het
Nckap1 T A 2: 80,332,635 (GRCm39) K1074N possibly damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nhsl1 T C 10: 18,399,700 (GRCm39) S275P probably damaging Het
Or2d3c A G 7: 106,526,483 (GRCm39) F61S possibly damaging Het
Or5k16 T A 16: 58,736,295 (GRCm39) K236N probably damaging Het
Pam G A 1: 97,780,910 (GRCm39) P514S possibly damaging Het
Pcdha4 C T 18: 37,086,392 (GRCm39) L192F probably damaging Het
Per1 T A 11: 68,996,397 (GRCm39) D800E probably benign Het
Plcg2 C A 8: 118,306,592 (GRCm39) N315K probably damaging Het
Plxnb2 T A 15: 89,042,525 (GRCm39) probably null Het
Pnpla1 A G 17: 29,077,781 (GRCm39) probably benign Het
Pptc7 A T 5: 122,446,192 (GRCm39) probably null Het
Psg26 G T 7: 18,209,225 (GRCm39) S394R probably benign Het
Psmc1 C A 12: 100,081,773 (GRCm39) T125K probably benign Het
Ptgis T A 2: 167,067,203 (GRCm39) M125L probably benign Het
Rbms1 A G 2: 60,589,165 (GRCm39) Y323H probably damaging Het
Rgl2 G A 17: 34,151,529 (GRCm39) R191Q probably benign Het
Sirpb1a G A 3: 15,476,503 (GRCm39) T98I possibly damaging Het
Sirpb1b C A 3: 15,607,200 (GRCm39) E361* probably null Het
Slc13a4 A T 6: 35,260,272 (GRCm39) probably null Het
Spag9 T C 11: 94,002,909 (GRCm39) S1140P probably damaging Het
Spata31e4 T A 13: 50,856,909 (GRCm39) I849N probably benign Het
Tas2r140 A G 6: 40,469,084 (GRCm39) N305D probably damaging Het
Tenm2 G A 11: 35,942,727 (GRCm39) A1314V probably benign Het
Tgm3 A G 2: 129,866,324 (GRCm39) T81A probably benign Het
Timeless T C 10: 128,085,399 (GRCm39) V839A probably damaging Het
Tmem132a A G 19: 10,837,492 (GRCm39) I606T probably damaging Het
Tox T A 4: 6,741,507 (GRCm39) M158L probably benign Het
Trpc2 A T 7: 101,739,275 (GRCm39) M549L probably damaging Het
Trpm5 C T 7: 142,635,572 (GRCm39) R600Q possibly damaging Het
Trpv1 A G 11: 73,131,367 (GRCm39) N302D probably damaging Het
Ttn C T 2: 76,681,940 (GRCm39) R1019H Het
Ttn G T 2: 76,775,307 (GRCm39) H1958N unknown Het
Usp32 A T 11: 84,917,938 (GRCm39) Y769* probably null Het
Vim A T 2: 13,583,443 (GRCm39) Q255L possibly damaging Het
Vmn1r84 T C 7: 12,095,994 (GRCm39) H233R probably benign Het
Xirp2 T A 2: 67,341,108 (GRCm39) H1116Q possibly damaging Het
Zc3h18 G T 8: 123,134,993 (GRCm39) R580L unknown Het
Zfp267 T A 3: 36,218,792 (GRCm39) F272I possibly damaging Het
Zfp442 A T 2: 150,250,676 (GRCm39) C409S unknown Het
Zfy1 A T Y: 759,852 (GRCm39) I20K unknown Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCCTTTGAGTGATGGC -3'
(R):5'- AAAATCCAGGATTCCCAATAGAGG -3'

Sequencing Primer
(F):5'- CCCTTTGAGTGATGGCTGCTTC -3'
(R):5'- GCTCAGTGTGTGACCTCAAATCAG -3'
Posted On 2019-10-18