Incidental Mutation 'R7514:Acap2'
ID585933
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 2
SynonymsCentb2, 9530039J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31092412-31201245 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 31154567 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229010
Predicted Effect probably null
Transcript: ENSMUST00000230614
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably null
Transcript: ENSMUST00000231125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dnah14 T C 1: 181,628,067 I919T probably damaging Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Gphn T C 12: 78,626,165 V485A probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc16a13 C T 11: 70,218,884 V264M probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Son T G 16: 91,654,860 L165R probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Utrn A G 10: 12,698,089 V1079A probably benign Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Ylpm1 C T 12: 85,030,494 P1331L possibly damaging Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1251:Acap2 UTSW 16 31108171 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R5578:Acap2 UTSW 16 31108114 missense probably benign 0.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7262:Acap2 UTSW 16 31127319 critical splice donor site probably null
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R7958:Acap2 UTSW 16 31139641 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTACAGAATATTGAAAGGGATCC -3'
(R):5'- TGAAGGCACTACATGATCACTCC -3'

Sequencing Primer
(F):5'- GGACAGTCTGCAGATCAAGTTCC -3'
(R):5'- GGCACTACATGATCACTCCCTTCTC -3'
Posted On2019-10-18