Incidental Mutation 'R7517:Atf7ip2'
ID585938
Institutional Source Beutler Lab
Gene Symbol Atf7ip2
Ensembl Gene ENSMUSG00000039200
Gene Nameactivating transcription factor 7 interacting protein 2
Synonyms4930558K11Rik, PSM2, Get-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location10192712-10251478 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 10241535 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044005] [ENSMUST00000044005] [ENSMUST00000117220] [ENSMUST00000119023] [ENSMUST00000230872]
Predicted Effect probably null
Transcript: ENSMUST00000044005
SMART Domains Protein: ENSMUSP00000036731
Gene: ENSMUSG00000039200

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 59 270 4.7e-75 PFAM
low complexity region 322 336 N/A INTRINSIC
FN3 346 435 7.55e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000044005
SMART Domains Protein: ENSMUSP00000036731
Gene: ENSMUSG00000039200

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 59 270 4.7e-75 PFAM
low complexity region 322 336 N/A INTRINSIC
FN3 346 435 7.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117220
SMART Domains Protein: ENSMUSP00000113573
Gene: ENSMUSG00000039200

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119023
SMART Domains Protein: ENSMUSP00000113480
Gene: ENSMUSG00000039200

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230872
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Atf7ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Atf7ip2 APN 16 10241885 missense probably damaging 0.99
IGL01937:Atf7ip2 APN 16 10241537 splice site probably null
IGL02301:Atf7ip2 APN 16 10211047 missense probably benign 0.32
R0575:Atf7ip2 UTSW 16 10237211 missense probably damaging 1.00
R0671:Atf7ip2 UTSW 16 10241879 missense possibly damaging 0.86
R1119:Atf7ip2 UTSW 16 10240612 missense possibly damaging 0.83
R1182:Atf7ip2 UTSW 16 10241835 missense possibly damaging 0.93
R1302:Atf7ip2 UTSW 16 10240608 missense possibly damaging 0.84
R1346:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1349:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1372:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1672:Atf7ip2 UTSW 16 10209141 missense probably damaging 1.00
R1696:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1897:Atf7ip2 UTSW 16 10211084 missense probably damaging 0.97
R1932:Atf7ip2 UTSW 16 10241703 missense possibly damaging 0.86
R2143:Atf7ip2 UTSW 16 10240645 missense probably null 0.68
R4612:Atf7ip2 UTSW 16 10241563 missense probably benign 0.33
R4732:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4733:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4934:Atf7ip2 UTSW 16 10241583 missense possibly damaging 0.72
R6137:Atf7ip2 UTSW 16 10201411 missense probably damaging 0.99
R6432:Atf7ip2 UTSW 16 10204670 missense probably damaging 1.00
R7298:Atf7ip2 UTSW 16 10209168 missense possibly damaging 0.82
R7744:Atf7ip2 UTSW 16 10241658 missense possibly damaging 0.93
R8124:Atf7ip2 UTSW 16 10209135 missense possibly damaging 0.67
R8245:Atf7ip2 UTSW 16 10201398 missense possibly damaging 0.93
R8527:Atf7ip2 UTSW 16 10237265 intron probably benign
U24488:Atf7ip2 UTSW 16 10204673 missense probably damaging 0.96
X0062:Atf7ip2 UTSW 16 10209274 splice site probably null
Z1177:Atf7ip2 UTSW 16 10241640 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCCTAGGACATCCTTCATTATGG -3'
(R):5'- ATGTTCCATGTCAGGGCAATG -3'

Sequencing Primer
(F):5'- AGCAATCTGAATGGCTCCTG -3'
(R):5'- CAATGCTTGTGGGCCTCAG -3'
Posted On2019-10-18