Incidental Mutation 'R7526:Card11'
ID 585945
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Name caspase recruitment domain family, member 11
Synonyms CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 140872990-141000582 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 140913429 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000085786
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Ace UTSW 5 140902877 missense possibly damaging 0.70
Caravaggio UTSW 5 140913309 missense probably damaging 1.00
Dealer UTSW 5 140885877 missense probably damaging 1.00
Dogs UTSW 5 140882000 critical splice donor site probably null
Face UTSW 5 140900977 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
Poker UTSW 5 140878082 missense probably benign
Sharp UTSW 5 140876425 missense possibly damaging 0.93
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 splice site probably null
PIT4243001:Card11 UTSW 5 140908604 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140876408 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140906660 missense probably damaging 0.99
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
R7008:Card11 UTSW 5 140873393 missense probably damaging 1.00
R7291:Card11 UTSW 5 140901070 missense probably damaging 1.00
R7376:Card11 UTSW 5 140898238 missense probably benign 0.01
R7683:Card11 UTSW 5 140896026 missense probably benign
R7730:Card11 UTSW 5 140885996 missense probably damaging 0.96
R7813:Card11 UTSW 5 140899664 missense probably damaging 1.00
R7831:Card11 UTSW 5 140873412 missense possibly damaging 0.61
R7911:Card11 UTSW 5 140882000 critical splice donor site probably null
R8154:Card11 UTSW 5 140900977 missense probably damaging 1.00
R8224:Card11 UTSW 5 140902877 missense possibly damaging 0.70
R8272:Card11 UTSW 5 140890039 missense probably damaging 1.00
R8714:Card11 UTSW 5 140913392 missense possibly damaging 0.67
R8715:Card11 UTSW 5 140885560 missense probably benign 0.00
R9065:Card11 UTSW 5 140908542 missense probably damaging 1.00
R9211:Card11 UTSW 5 140883620 missense probably benign 0.16
R9215:Card11 UTSW 5 140880399 missense possibly damaging 0.64
R9269:Card11 UTSW 5 140906761 missense probably damaging 0.99
R9385:Card11 UTSW 5 140885521 missense probably benign 0.44
R9421:Card11 UTSW 5 140883707 missense probably damaging 0.97
R9424:Card11 UTSW 5 140908640 missense probably damaging 1.00
R9444:Card11 UTSW 5 140908638 missense probably damaging 1.00
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140898241 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATCGATGACCTTGCACTGGC -3'
(R):5'- AATGACAGGACTTTCCATCTCTC -3'

Sequencing Primer
(F):5'- TTGCACTGGCGCAGGTAG -3'
(R):5'- ACAGCTCATCTTTCTATTGTTTGGTG -3'
Posted On 2019-10-18