Incidental Mutation 'R0620:Bod1l'
ID 58595
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Name biorientation of chromosomes in cell division 1-like
Synonyms A230054D04Rik
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 41787538-41844315 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41801233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 2750 (N2750S)
Ref Sequence ENSEMBL: ENSMUSP00000144359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050556
AA Change: N2750S

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: N2750S

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202908
AA Change: N2750S

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: N2750S

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
gauss UTSW 5 41816867 missense probably benign 0.01
Tesla UTSW 5 41795068 critical splice donor site probably null
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
R7860:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R7975:Bod1l UTSW 5 41816277 missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41795070 missense probably damaging 1.00
R7987:Bod1l UTSW 5 41795070 missense probably damaging 1.00
R8104:Bod1l UTSW 5 41833732 nonsense probably null
R8217:Bod1l UTSW 5 41831507 missense probably damaging 1.00
R8307:Bod1l UTSW 5 41821155 missense probably damaging 1.00
R8469:Bod1l UTSW 5 41821491 missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41819055 nonsense probably null
R8934:Bod1l UTSW 5 41819601 missense probably benign 0.11
R8984:Bod1l UTSW 5 41788872 missense probably damaging 1.00
R8989:Bod1l UTSW 5 41821682 missense probably benign 0.00
R8993:Bod1l UTSW 5 41816867 missense probably benign 0.01
R9128:Bod1l UTSW 5 41788923 missense probably benign 0.22
R9129:Bod1l UTSW 5 41818877 missense probably damaging 0.99
R9198:Bod1l UTSW 5 41799786 missense probably benign 0.08
R9254:Bod1l UTSW 5 41821880 missense probably damaging 1.00
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTCCAGCAGGTGAAACTTGGT -3'
(R):5'- AACAGTTCCAGTAACTGCAATGATGGT -3'

Sequencing Primer
(F):5'- TGCAAGGTGTGGCACTG -3'
(R):5'- caacagtatgaactaaccagtacc -3'
Posted On 2013-07-11