Incidental Mutation 'R7531:Arfgap2'
ID585951
Institutional Source Beutler Lab
Gene Symbol Arfgap2
Ensembl Gene ENSMUSG00000027255
Gene NameADP-ribosylation factor GTPase activating protein 2
Synonyms2310032E02Rik, Zfp289
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R7531 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91264974-91276931 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 91273744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000064652] [ENSMUST00000080008] [ENSMUST00000094835] [ENSMUST00000102594]
Predicted Effect probably null
Transcript: ENSMUST00000028691
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064652
Predicted Effect probably null
Transcript: ENSMUST00000080008
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094835
SMART Domains Protein: ENSMUSP00000092431
Gene: ENSMUSG00000040591

DomainStartEndE-ValueType
low complexity region 219 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102594
SMART Domains Protein: ENSMUSP00000099654
Gene: ENSMUSG00000040591

DomainStartEndE-ValueType
low complexity region 316 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a zinc-finger-containing GTPase-activating protein for ADP ribosylation factor 1 (ARF1), a small GTPase that plays a role in coatomer-mediated vesicular trafficking. This gene product stimulates the hydrolysis of ARF1-bound GTP, which may lead to dissociation of coatomer from Golgi-derived membranes to allow fusion with target membranes. It may regulate the retrograde transport from the Golgi complex to the endoplasmic reticulum. Expression of this gene has been shown to be controlled by inhibitor of DNA binding 1 (Id1). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,140,231 F490L probably benign Het
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Fam114a2 A G 11: 57,513,716 V74A probably benign Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Naa35 A T 13: 59,617,941 K380* probably null Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Nr1h3 C T 2: 91,184,394 R427H probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pate2 A G 9: 35,670,712 probably null Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Scn4a A G 11: 106,348,697 probably null Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in Arfgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0178:Arfgap2 UTSW 2 91267361 missense probably benign 0.00
R0927:Arfgap2 UTSW 2 91273805 missense probably benign 0.05
R1491:Arfgap2 UTSW 2 91274859 missense probably damaging 1.00
R1693:Arfgap2 UTSW 2 91270075 splice site probably null
R2091:Arfgap2 UTSW 2 91270241 missense probably benign 0.02
R2199:Arfgap2 UTSW 2 91265692 critical splice donor site probably null
R3772:Arfgap2 UTSW 2 91265366 missense probably benign
R3922:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R3926:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R4707:Arfgap2 UTSW 2 91269971 missense probably damaging 1.00
R4751:Arfgap2 UTSW 2 91267368 missense probably benign 0.10
R4923:Arfgap2 UTSW 2 91273659 missense probably damaging 1.00
R5249:Arfgap2 UTSW 2 91265637 nonsense probably null
R5541:Arfgap2 UTSW 2 91275769 missense probably benign 0.09
R5608:Arfgap2 UTSW 2 91270202 missense probably damaging 1.00
R5626:Arfgap2 UTSW 2 91275392 nonsense probably null
R6261:Arfgap2 UTSW 2 91270282 missense probably benign 0.00
R6300:Arfgap2 UTSW 2 91267195 missense probably benign 0.00
R6948:Arfgap2 UTSW 2 91267179 missense probably benign 0.00
R8058:Arfgap2 UTSW 2 91266299 critical splice donor site probably null
Z1177:Arfgap2 UTSW 2 91275104 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTGTGCTGTCTGAGATGCAG -3'
(R):5'- CAGTGCAGCTGTCAATCATTTC -3'

Sequencing Primer
(F):5'- CAGATGATTGAGCAGGAAACCCC -3'
(R):5'- TGCATCAAGTTCTGCAGACAG -3'
Posted On2019-10-18