Incidental Mutation 'R7531:Pate2'
ID585952
Institutional Source Beutler Lab
Gene Symbol Pate2
Ensembl Gene ENSMUSG00000074452
Gene Nameprostate and testis expressed 2
SynonymsmANLP1, LOC330921
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7531 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35570284-35690318 bp(+) (GRCm38)
Type of Mutationintron (102 bp from exon)
DNA Base Change (assembly) A to G at 35670712 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000098906] [ENSMUST00000118254]
Predicted Effect probably null
Transcript: ENSMUST00000098906
SMART Domains Protein: ENSMUSP00000096505
Gene: ENSMUSG00000074452

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118254
SMART Domains Protein: ENSMUSP00000113239
Gene: ENSMUSG00000074452

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217565
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,140,231 F490L probably benign Het
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arfgap2 T A 2: 91,273,744 probably null Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Fam114a2 A G 11: 57,513,716 V74A probably benign Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Naa35 A T 13: 59,617,941 K380* probably null Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Nr1h3 C T 2: 91,184,394 R427H probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Scn4a A G 11: 106,348,697 probably null Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in Pate2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Pate2 APN 9 35669702 start codon destroyed probably null
IGL01729:Pate2 APN 9 35670592 missense probably damaging 1.00
IGL03055:Pate2 APN 9 35611773 splice site probably benign
foie_gras UTSW 9 35670501 nonsense probably null
PIT4576001:Pate2 UTSW 9 35670593 missense probably damaging 1.00
R1229:Pate2 UTSW 9 35669695 missense probably damaging 0.98
R1397:Pate2 UTSW 9 35669695 missense probably damaging 0.98
R2393:Pate2 UTSW 9 35669740 splice site probably benign
R2426:Pate2 UTSW 9 35670480 critical splice acceptor site probably null
R3407:Pate2 UTSW 9 35670966 missense probably damaging 0.99
R4323:Pate2 UTSW 9 35670471 splice site probably benign
R4574:Pate2 UTSW 9 35685673 intron probably benign
R4716:Pate2 UTSW 9 35685682 intron probably benign
R5023:Pate2 UTSW 9 35686111 intron probably benign
R5057:Pate2 UTSW 9 35686111 intron probably benign
R5384:Pate2 UTSW 9 35670541 missense probably damaging 0.98
R5574:Pate2 UTSW 9 35686115 intron probably benign
R5593:Pate2 UTSW 9 35670482 missense possibly damaging 0.76
R5851:Pate2 UTSW 9 35670501 nonsense probably null
R6510:Pate2 UTSW 9 35669722 missense probably null 0.99
R6800:Pate2 UTSW 9 35685645 intron probably benign
R6819:Pate2 UTSW 9 35670505 missense probably damaging 1.00
R7765:Pate2 UTSW 9 35669901 missense probably benign 0.15
R7842:Pate2 UTSW 9 35670533 missense probably damaging 1.00
R7925:Pate2 UTSW 9 35670533 missense probably damaging 1.00
R8015:Pate2 UTSW 9 35670518 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCATGACATCCTGCGTACC -3'
(R):5'- CATACTCTGCCCTGAGGAAGTG -3'

Sequencing Primer
(F):5'- TGACATCCTGCGTACCAAATCATAG -3'
(R):5'- CTCTGCCCTGAGGAAGTGAAAGG -3'
Posted On2019-10-18