Incidental Mutation 'R7531:Scn4a'
ID585954
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7531 (G1)
Quality Score156.008
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 106348697 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably null
Transcript: ENSMUST00000021056
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,140,231 F490L probably benign Het
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arfgap2 T A 2: 91,273,744 probably null Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Fam114a2 A G 11: 57,513,716 V74A probably benign Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Naa35 A T 13: 59,617,941 K380* probably null Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Nr1h3 C T 2: 91,184,394 R427H probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pate2 A G 9: 35,670,712 probably null Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 intron probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7915:Scn4a UTSW 11 106322015 missense probably benign 0.01
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATCCCTGTGAAGGTGTACC -3'
(R):5'- GTGCTCATCCACGCATATCC -3'

Sequencing Primer
(F):5'- ATAAGGCTACCCAGGGCTG -3'
(R):5'- GCATATCCTGCCTACGTGG -3'
Posted On2019-10-18