Incidental Mutation 'R7532:Kng2'
ID585955
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Namekininogen 2
SynonymsKininogen-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location22985854-23029482 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 23027044 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243] [ENSMUST00000231835] [ENSMUST00000232459]
Predicted Effect probably null
Transcript: ENSMUST00000039338
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100046
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115349
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231835
Predicted Effect probably null
Transcript: ENSMUST00000232459
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 23028830 missense probably damaging 1.00
IGL01319:Kng2 APN 16 23028834 missense probably damaging 0.99
IGL01469:Kng2 APN 16 22999827 missense probably damaging 1.00
IGL01681:Kng2 APN 16 22997017 splice site probably benign
IGL01830:Kng2 APN 16 22988051 missense probably damaging 0.97
IGL01903:Kng2 APN 16 22987790 missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22987832 missense probably damaging 0.97
IGL02305:Kng2 APN 16 23000624 unclassified probably benign
IGL02429:Kng2 APN 16 23012079 missense probably damaging 0.99
FR4548:Kng2 UTSW 16 23000552 nonsense probably null
R0020:Kng2 UTSW 16 22997296 missense probably benign 0.02
R0047:Kng2 UTSW 16 22987563 missense possibly damaging 0.83
R0245:Kng2 UTSW 16 23012181 splice site probably benign
R0610:Kng2 UTSW 16 23000594 missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22987736 missense probably benign 0.10
R0666:Kng2 UTSW 16 22997122 splice site probably benign
R1552:Kng2 UTSW 16 22987520 missense probably damaging 1.00
R1765:Kng2 UTSW 16 22988243 critical splice donor site probably null
R1833:Kng2 UTSW 16 23012052 missense possibly damaging 0.95
R1997:Kng2 UTSW 16 23024876 missense possibly damaging 0.84
R2025:Kng2 UTSW 16 23000575 missense probably benign 0.15
R2056:Kng2 UTSW 16 22987953 intron probably benign
R2137:Kng2 UTSW 16 22997326 intron probably benign
R2517:Kng2 UTSW 16 22988315 missense probably benign 0.24
R3438:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3439:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3551:Kng2 UTSW 16 23011995 critical splice donor site probably null
R4389:Kng2 UTSW 16 23024868 missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22988063 missense probably benign 0.00
R4684:Kng2 UTSW 16 22987641 missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22987916 missense probably damaging 1.00
R5658:Kng2 UTSW 16 22997020 splice site probably null
R6074:Kng2 UTSW 16 23000596 missense probably benign 0.03
R6216:Kng2 UTSW 16 22987593 missense probably damaging 1.00
R6271:Kng2 UTSW 16 23003948 missense probably benign 0.33
R6459:Kng2 UTSW 16 23012115 missense probably damaging 1.00
R7124:Kng2 UTSW 16 23012055 missense probably damaging 1.00
R7310:Kng2 UTSW 16 22987772 missense probably benign 0.00
R7667:Kng2 UTSW 16 22988232 missense probably damaging 0.99
R7787:Kng2 UTSW 16 22999848 missense probably damaging 1.00
R8092:Kng2 UTSW 16 22987922 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAAGGATCACTTAGTGACAG -3'
(R):5'- GTTTGTAATGTGTCAGTATCCCC -3'

Sequencing Primer
(F):5'- ATCACTTAGTGACAGATAGACTGG -3'
(R):5'- AATGTGTCAGTATCCCCTGAGTGAC -3'
Posted On2019-10-18