Mutagenetix > Incidental Mutation

Incidental Mutation 'R0620:Adamts9'

58597

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

038809-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92858113 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 679 (T679A)

Ref Sequence

ENSEMBL: ENSMUSP00000126498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]

AlphaFold

E9PUN6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113438
AA Change: T1260A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: T1260A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167391
AA Change: T679A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: T679A

Domain	Start	End	E-Value	Type
TSP1	10	62	2.15e-9	SMART
Pfam:ADAM_spacer1	172	290	6.1e-35	PFAM
TSP1	300	355	1.14e0	SMART
Blast:TSP1	357	412	3e-28	BLAST
TSP1	419	473	3.78e-5	SMART
TSP1	474	528	5.64e-4	SMART
TSP1	529	585	1.25e-5	SMART
TSP1	605	659	1.45e-6	SMART
TSP1	661	715	4.41e-6	SMART
TSP1	747	799	7.06e-5	SMART
TSP1	800	855	4.24e-8	SMART
TSP1	859	914	8.23e-6	SMART
TSP1	915	970	1.23e-4	SMART
TSP1	971	1028	2e-4	SMART
TSP1	1030	1091	1.25e-5	SMART
TSP1	1095	1149	3.47e-4	SMART
Pfam:GON	1150	1350	2.1e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203690

Meta Mutation Damage Score

0.4536

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,328,375	Q973L	probably damaging	Het
Ahr	T	C	12: 35,508,194	T276A	probably benign	Het
Akap9	A	T	5: 4,064,136	Q3138H	probably damaging	Het
Armt1	T	A	10: 4,432,689	F7I	probably benign	Het
B3galt2	A	G	1: 143,646,140	R5G	probably damaging	Het
Bod1l	T	C	5: 41,801,233	N2750S	probably benign	Het
Cadps2	T	A	6: 23,583,396	E365V	probably damaging	Het
Cd200r3	T	A	16: 44,957,717		probably null	Het
Cst7	T	A	2: 150,575,886		probably benign	Het
Defb30	A	T	14: 63,049,763		probably benign	Het
Dido1	C	T	2: 180,659,851	G2087S	probably benign	Het
Dio2	A	G	12: 90,738,071	Y72H	probably benign	Het
Dnah11	C	T	12: 117,987,469	E3035K	probably damaging	Het
Dnajb13	T	C	7: 100,503,249	K287E	possibly damaging	Het
Dnajc11	G	A	4: 151,973,628	V244I	possibly damaging	Het
Ect2	C	T	3: 27,139,652	A226T	probably damaging	Het
Ercc8	G	A	13: 108,174,061		probably null	Het
Fam120b	T	A	17: 15,402,927	M389K	probably benign	Het
Fam151a	A	G	4: 106,747,931	M497V	probably benign	Het
Fam186b	C	A	15: 99,280,128	G439V	probably benign	Het
Fank1	A	G	7: 133,876,765	Y185C	probably damaging	Het
Gart	T	C	16: 91,630,602		probably benign	Het
Glb1l	T	C	1: 75,199,720	Y572C	probably damaging	Het
Gm11563	C	T	11: 99,658,437	A164T	unknown	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Gsdmc3	T	A	15: 63,859,693	D330V	probably damaging	Het
H2-DMa	C	T	17: 34,137,960	T144M	probably damaging	Het
Haus6	A	T	4: 86,583,514	F707I	possibly damaging	Het
Hmcn1	T	A	1: 150,594,016	T4971S	probably benign	Het
Ints6	A	T	14: 62,696,759	F766L	probably benign	Het
Kdm5d	T	A	Y: 927,330	M650K	probably damaging	Het
Kif21b	T	C	1: 136,159,428	F881S	possibly damaging	Het
Klrk1	C	A	6: 129,614,635	Q176H	possibly damaging	Het
Ky	T	C	9: 102,537,621	V244A	probably benign	Het
Mia2	T	A	12: 59,154,419	L191M	possibly damaging	Het
Miga2	T	A	2: 30,381,744		probably benign	Het
Mtss1l	C	T	8: 110,737,948	P322S	probably damaging	Het
Nalcn	A	G	14: 123,299,141		probably benign	Het
Ncbp3	T	A	11: 73,049,845		probably benign	Het
Nprl3	G	A	11: 32,234,876	L378F	probably damaging	Het
Ntrk2	A	T	13: 58,846,821	M184L	probably benign	Het
Olfr311	T	G	11: 58,841,443	C110G	probably damaging	Het
Olfr738	G	T	14: 50,413,697	C51F	probably benign	Het
Osbpl9	T	C	4: 109,083,128	E287G	probably damaging	Het
Parva	T	C	7: 112,576,411	F250L	probably damaging	Het
Pcdhb11	C	T	18: 37,421,811	Q65*	probably null	Het
Phtf1	A	G	3: 103,993,765	T377A	probably damaging	Het
Pkp4	G	A	2: 59,322,643	V612I	possibly damaging	Het
Plscr2	C	A	9: 92,287,654	S52R	probably benign	Het
Pnisr	C	T	4: 21,874,092		probably benign	Het
Pole2	A	C	12: 69,209,879	S291A	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,018	F586L	probably benign	Het
Prrx1	G	A	1: 163,257,816	R182C	probably damaging	Het
Ptprs	A	G	17: 56,429,103	I110T	possibly damaging	Het
Rasgrf2	G	A	13: 91,919,817		probably benign	Het
Riox2	T	C	16: 59,491,892	V464A	probably benign	Het
Robo2	A	G	16: 73,967,802	V646A	possibly damaging	Het
Ros1	T	A	10: 52,118,348	I1279F	probably damaging	Het
Siglec1	G	A	2: 131,074,268	T1254M	probably benign	Het
Snx7	T	C	3: 117,846,675	N62D	probably damaging	Het
Sp100	G	A	1: 85,659,867		probably null	Het
Stil	A	T	4: 115,007,159	I86L	possibly damaging	Het
Tbc1d16	T	A	11: 119,209,038	D170V	probably benign	Het
Tmem2	T	A	19: 21,817,971	S743T	probably benign	Het
Trappc13	G	A	13: 104,161,081	T105M	probably damaging	Het
Trhr	T	A	15: 44,229,500	S378T	probably benign	Het
Ttc7b	T	C	12: 100,500,073		probably null	Het
Vegfc	A	T	8: 54,157,139	Y110F	probably benign	Het
Vmn1r184	C	A	7: 26,267,177	P116H	possibly damaging	Het
Vmn2r5	A	T	3: 64,503,814	C444*	probably null	Het
Zfp341	A	G	2: 154,634,273	E460G	possibly damaging	Het
Zfp819	T	A	7: 43,616,444	V41E	probably benign	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R1986:Adamts9	UTSW	6	92796394	missense	probably benign
R2370:Adamts9	UTSW	6	92860203	missense	probably damaging	0.99
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5260:Adamts9	UTSW	6	92807137	missense	probably benign	0.00
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7028:Adamts9	UTSW	6	92909793	nonsense	probably null
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7791:Adamts9	UTSW	6	92872385	missense	probably benign	0.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R7974:Adamts9	UTSW	6	92909687	critical splice donor site	probably null
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAAGTGTGTGCCCATAATCTTTCG -3'
(R):5'- GTCAAGTCCTAAGCAGAAGAGCCC -3'

Sequencing Primer
(F):5'- TCGAAGGAACCAATTCTAGTCTGC -3'
(R):5'- ATGGAAACAGaaggaagcagtc -3'

Posted On

2013-07-11