Incidental Mutation 'R7540:Pcsk7'
ID585970
Institutional Source Beutler Lab
Gene Symbol Pcsk7
Ensembl Gene ENSMUSG00000035382
Gene Nameproprotein convertase subtilisin/kexin type 7
SynonymsSPC7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7540 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location45906497-45929726 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 45927673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034590] [ENSMUST00000039059] [ENSMUST00000215189] [ENSMUST00000215509] [ENSMUST00000216672]
Predicted Effect probably benign
Transcript: ENSMUST00000034590
SMART Domains Protein: ENSMUSP00000034590
Gene: ENSMUSG00000032085

DomainStartEndE-ValueType
CH 26 133 1.53e-20 SMART
Pfam:Calponin 175 199 5.5e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039059
SMART Domains Protein: ENSMUSP00000047508
Gene: ENSMUSG00000035382

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:S8_pro-domain 52 140 9.7e-21 PFAM
Pfam:Peptidase_S8 177 464 4.7e-43 PFAM
Pfam:P_proprotein 524 611 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215189
Predicted Effect probably benign
Transcript: ENSMUST00000215509
Predicted Effect probably null
Transcript: ENSMUST00000216672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Pcsk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Pcsk7 APN 9 45927660 missense probably benign
IGL01081:Pcsk7 APN 9 45928707 missense probably benign
IGL02634:Pcsk7 APN 9 45919262 missense possibly damaging 0.87
IGL02999:Pcsk7 APN 9 45927599 missense possibly damaging 0.68
IGL03115:Pcsk7 APN 9 45914372 missense probably damaging 1.00
IGL03149:Pcsk7 APN 9 45909480 missense probably benign 0.37
R0243:Pcsk7 UTSW 9 45916059 missense probably damaging 1.00
R0324:Pcsk7 UTSW 9 45913011 missense possibly damaging 0.87
R0947:Pcsk7 UTSW 9 45911172 missense probably damaging 1.00
R1443:Pcsk7 UTSW 9 45925986 missense probably damaging 1.00
R1545:Pcsk7 UTSW 9 45914348 missense probably damaging 1.00
R2182:Pcsk7 UTSW 9 45928619 missense probably benign
R2939:Pcsk7 UTSW 9 45916024 missense probably damaging 1.00
R3739:Pcsk7 UTSW 9 45926759 missense possibly damaging 0.72
R4039:Pcsk7 UTSW 9 45928007 splice site probably null
R4348:Pcsk7 UTSW 9 45919348 missense probably damaging 1.00
R4974:Pcsk7 UTSW 9 45918862 missense probably damaging 1.00
R5817:Pcsk7 UTSW 9 45926033 missense probably benign 0.01
R6214:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6215:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6408:Pcsk7 UTSW 9 45909696 missense probably benign 0.18
R7338:Pcsk7 UTSW 9 45925989 missense probably benign 0.03
R7355:Pcsk7 UTSW 9 45909374 missense probably benign 0.03
R7475:Pcsk7 UTSW 9 45927625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTCTGCAGGACCCTTGC -3'
(R):5'- GAAACACTACTTATGCCATCTGCC -3'

Sequencing Primer
(F):5'- CACATGGTCTGGATTCCCTTGG -3'
(R):5'- TGCCCCAACCTTGTAGCTGAAG -3'
Posted On2019-10-18