Mutagenetix > Incidental Mutations

Incidental Mutation 'R7547:Clpb'

585987

Institutional Source

Beutler Lab

Gene Symbol

Clpb

Ensembl Gene

ENSMUSG00000001829

Gene Name

ClpB caseinolytic peptidase B

Synonyms

Skd3

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.891) question?

Stock #

R7547 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101663633-101795506 bp(+) (GRCm38)

Type of Mutation

intron (83 bp from exon)

DNA Base Change (assembly)

A to G at 101664296 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000123870] [ENSMUST00000209579]

Predicted Effect

probably null
Transcript: ENSMUST00000001884

SMART Domains

Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	235	264	6.65e-6	SMART
low complexity region	294	306	N/A	INTRINSIC
AAA	343	497	6.36e-10	SMART
ClpB_D2-small	541	630	6.83e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000106998

SMART Domains

Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	265	294	6.65e-6	SMART
low complexity region	324	336	N/A	INTRINSIC
AAA	373	527	6.36e-10	SMART
ClpB_D2-small	571	660	6.83e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123870

Predicted Effect

probably null
Transcript: ENSMUST00000209579

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	T	4: 53,109,269	D146E	probably benign	Het
Adgrl1	C	T	8: 83,938,884	A1400V	probably benign	Het
Ank2	A	G	3: 126,945,203	V2344A	unknown	Het
Aplnr	A	T	2: 85,137,177	D182V	probably damaging	Het
Asb4	C	T	6: 5,398,350	P105L	probably damaging	Het
Ate1	C	A	7: 130,504,809	R274I	probably benign	Het
Ccdc43	A	G	11: 102,692,122	V92A	probably benign	Het
Cfap69	T	A	5: 5,604,290	N548I	possibly damaging	Het
Ctnnal1	G	A	4: 56,817,032	R597C	probably damaging	Het
Dchs2	A	G	3: 83,356,127	K3234R	probably damaging	Het
Dnah7a	T	A	1: 53,663,837	K151N	probably benign	Het
Dnah7b	T	A	1: 46,214,413	I1826K	possibly damaging	Het
Dnttip1	A	G	2: 164,767,879	K289E	probably benign	Het
Eppk1	G	T	15: 76,107,540	Q1714K	probably benign	Het
Exoc4	A	G	6: 33,839,121	D674G	possibly damaging	Het
Galnt7	A	T	8: 57,583,962	V131D	possibly damaging	Het
Glg1	C	T	8: 111,187,761	V464M	possibly damaging	Het
Gm36079	A	T	13: 120,026,921	F31I	probably damaging	Het
Hlcs	G	T	16: 94,231,172	S444*	probably null	Het
Larp1	G	T	11: 58,052,579		probably null	Het
Macf1	T	C	4: 123,441,617	Y4386C	probably damaging	Het
Mapt	A	G	11: 104,322,312		probably null	Het
Neb	C	T	2: 52,282,625	V1557I	probably benign	Het
Nid2	A	G	14: 19,797,277	T953A	probably benign	Het
Olfr1458	T	C	19: 13,103,043	D87G	not run	Het
Papd7	G	T	13: 69,533,704	P160Q	probably benign	Het
Pax3	G	A	1: 78,122,594	Q319*	probably null	Het
Ppp2r1b	T	A	9: 50,862,462	S212R	probably benign	Het
Prss29	T	C	17: 25,320,922	L98P	probably damaging	Het
Ptch2	T	G	4: 117,109,964	L646R	probably damaging	Het
Rasa2	T	A	9: 96,611,421	E70V	probably damaging	Het
Serf2	A	G	2: 121,450,775	N65S	possibly damaging	Het
Serpinb6b	G	A	13: 32,974,924	G155D	probably benign	Het
Serpinb6c	A	G	13: 33,893,892	I165T	possibly damaging	Het
Skint5	A	T	4: 113,626,588	V949E	unknown	Het
Slc11a2	A	G	15: 100,397,770	I490T	possibly damaging	Het
Slx4	T	C	16: 3,985,572	D1126G	probably benign	Het
Tln1	G	T	4: 43,545,206	A1003E	possibly damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Trav21-dv12	T	C	14: 53,876,615	V64A	probably damaging	Het
U2surp	T	C	9: 95,479,349	E620G	possibly damaging	Het
Usp3	T	C	9: 66,542,624	N179S	possibly damaging	Het
Vps13d	T	C	4: 145,057,538	T3889A		Het
Vps35	C	T	8: 85,263,370	V670M	probably damaging	Het
Zfp626	T	C	7: 27,818,403	S270P	possibly damaging	Het
Zfp955a	C	T	17: 33,242,823	V112M	probably benign	Het
Zranb2	T	C	3: 157,541,169	S165P	possibly damaging	Het

Other mutations in Clpb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Clpb	APN	7	101787745	missense	probably benign
IGL00778:Clpb	APN	7	101778608	nonsense	probably null
IGL00780:Clpb	APN	7	101778608	nonsense	probably null
IGL00951:Clpb	APN	7	101751260	missense	probably benign	0.00
IGL01374:Clpb	APN	7	101773128	missense	probably damaging	1.00
IGL01542:Clpb	APN	7	101787505	missense	probably damaging	0.98
IGL02203:Clpb	APN	7	101779337	missense	probably damaging	1.00
IGL02989:Clpb	APN	7	101779220	missense	probably damaging	1.00
IGL03088:Clpb	APN	7	101785449	nonsense	probably null
Surfeit	UTSW	7	101711465	missense	probably damaging	1.00
PIT1430001:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
PIT4486001:Clpb	UTSW	7	101663932	missense	probably benign	0.17
R0611:Clpb	UTSW	7	101787749	missense	possibly damaging	0.71
R1565:Clpb	UTSW	7	101785461	missense	probably benign	0.00
R1760:Clpb	UTSW	7	101786698	missense	possibly damaging	0.92
R1879:Clpb	UTSW	7	101706483	missense	probably benign	0.23
R1933:Clpb	UTSW	7	101779211	missense	probably damaging	0.96
R1938:Clpb	UTSW	7	101763656	missense	probably damaging	1.00
R2922:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2923:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2995:Clpb	UTSW	7	101779324	missense	probably damaging	1.00
R4492:Clpb	UTSW	7	101787722	missense	probably damaging	1.00
R5384:Clpb	UTSW	7	101779341	missense	probably damaging	1.00
R5973:Clpb	UTSW	7	101663997	missense	probably benign	0.02
R6787:Clpb	UTSW	7	101663659	unclassified	probably benign
R7158:Clpb	UTSW	7	101663832	missense	probably benign	0.45
R7225:Clpb	UTSW	7	101711465	missense	probably damaging	1.00
R7239:Clpb	UTSW	7	101711455	missense	probably damaging	0.96
R7482:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
R7499:Clpb	UTSW	7	101722728	missense	possibly damaging	0.92
R7769:Clpb	UTSW	7	101722717	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGATCCCATACCTGACTGCC -3'
(R):5'- GACCGGGCTGTAATTAGTCAG -3'

Sequencing Primer
(F):5'- ACAGCTGGAATGGGGTCC -3'
(R):5'- GGCTGTAATTAGTCAGTCCAATGTCC -3'

Posted On

2019-10-18