Incidental Mutation 'R7556:Tulp2'
ID585999
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Nametubby-like protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7556 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45481877-45523632 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 45518581 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210532] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212]
Predicted Effect probably null
Transcript: ENSMUST00000024233
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085331
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107762
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect probably null
Transcript: ENSMUST00000210813
Predicted Effect probably null
Transcript: ENSMUST00000210868
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,310,313 W11* probably null Het
A2ml1 A G 6: 128,569,964 S401P probably damaging Het
Adamtsl1 T A 4: 86,277,121 Y592N probably benign Het
Adh6b C T 3: 138,352,785 T76I probably damaging Het
Aebp2 C A 6: 140,677,411 P503Q probably benign Het
Ankrd2 A G 19: 42,040,400 D134G Het
Atf7ip T C 6: 136,561,241 S491P probably damaging Het
Atp1a3 T C 7: 24,981,566 D832G probably benign Het
Atrnl1 G A 19: 57,654,846 V389I probably benign Het
Bahcc1 T C 11: 120,287,763 S2383P probably damaging Het
BC051142 A T 17: 34,437,717 I103F unknown Het
Brd9 A G 13: 73,944,767 D292G possibly damaging Het
Cacna1e G T 1: 154,472,673 Q781K probably benign Het
Ccdc9 T C 7: 16,284,566 probably benign Het
Cdc42ep4 C G 11: 113,728,540 E342Q probably damaging Het
Celf3 C T 3: 94,480,283 T54M probably damaging Het
Cenpn T C 8: 116,937,269 Y267H probably damaging Het
Chrnb4 T C 9: 55,035,055 T312A probably benign Het
Clcn3 T A 8: 60,929,487 T383S probably damaging Het
Cln3 T C 7: 126,575,070 Q327R probably damaging Het
Cnep1r1 T C 8: 88,125,133 L50P probably damaging Het
Cnot6 T C 11: 49,675,317 N512S probably benign Het
Col7a1 T A 9: 108,982,465 probably null Het
Cryba4 C T 5: 112,251,103 R25Q probably damaging Het
Dnah5 A G 15: 28,290,243 I1260V probably null Het
Dock2 G T 11: 34,720,951 T195K probably benign Het
Dpp9 A T 17: 56,190,012 I740N possibly damaging Het
Fbxl21 A T 13: 56,526,928 N31Y probably benign Het
Frat1 G A 19: 41,830,520 R118Q possibly damaging Het
Gna11 A G 10: 81,531,374 F228S Het
Golgb1 A T 16: 36,915,793 M1842L probably benign Het
Got1 A T 19: 43,503,030 M327K probably damaging Het
Hexa T A 9: 59,563,299 L468Q probably damaging Het
Hist1h4i A G 13: 22,041,244 I27T probably damaging Het
Ift57 G A 16: 49,706,128 V178I probably benign Het
Kbtbd13 T C 9: 65,391,475 T60A probably benign Het
Klk5 A G 7: 43,847,225 T194A probably damaging Het
Krtap16-3 C A 16: 88,962,778 G16C unknown Het
Lamb3 T C 1: 193,332,449 S639P probably benign Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mcf2l A G 8: 12,973,071 T86A probably damaging Het
Mecom G T 3: 29,987,071 H125N probably benign Het
Med18 T C 4: 132,459,936 H84R probably benign Het
Muc2 A G 7: 141,753,702 Y798C Het
Mycbp T C 4: 123,905,267 Y17H probably damaging Het
Nacad C T 11: 6,601,272 V640M possibly damaging Het
Ncoa1 C T 12: 4,270,794 V1092I probably damaging Het
Nomo1 A G 7: 46,066,218 E696G probably damaging Het
Notch4 G A 17: 34,575,470 C741Y probably damaging Het
Olfr212 C T 6: 116,516,736 Q320* probably null Het
Olfr978 A G 9: 39,994,682 N291D probably damaging Het
Osbpl10 C A 9: 115,207,624 H229Q probably damaging Het
Pif1 A T 9: 65,589,711 probably null Het
Plk2 T G 13: 110,396,588 probably null Het
Ppp1r42 T C 1: 9,995,183 H172R probably benign Het
Ring1 A G 17: 34,021,714 I363T possibly damaging Het
Rnf168 T G 16: 32,299,045 Y475D probably damaging Het
Sbf2 T A 7: 110,314,053 K1671N probably benign Het
Sema6d A G 2: 124,654,189 N51S probably damaging Het
Setx C A 2: 29,146,493 Q997K possibly damaging Het
Skint5 T G 4: 113,567,965 Q1088P unknown Het
Slc22a27 T C 19: 7,865,754 D528G probably damaging Het
Slc6a7 T A 18: 61,007,442 K173* probably null Het
Smc2 T C 4: 52,457,379 F380L probably benign Het
Spata31d1a T C 13: 59,701,984 M777V probably benign Het
Stkld1 A T 2: 26,947,295 N319I possibly damaging Het
Tanc2 T C 11: 105,909,031 V93A Het
Tbx20 T C 9: 24,750,277 probably null Het
Trbv20 G A 6: 41,188,781 V47I probably benign Het
Trip4 A T 9: 65,874,873 C192* probably null Het
Ush2a C A 1: 188,957,493 P5084Q probably benign Het
Virma T C 4: 11,518,927 Y675H probably damaging Het
Vmn2r102 T A 17: 19,677,831 N369K probably benign Het
Vmn2r59 A T 7: 42,045,809 M393K probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Xpot A G 10: 121,613,506 S30P probably benign Het
Zfp947 T C 17: 22,145,616 Y359C probably benign Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45521908 missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45516268 missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45520795 missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45522310 missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45521858 missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45516272 missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0306:Tulp2 UTSW 7 45518576 unclassified probably benign
R0648:Tulp2 UTSW 7 45519786 missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45520808 missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45517842 missense probably benign
R1345:Tulp2 UTSW 7 45518721 missense probably benign 0.13
R1737:Tulp2 UTSW 7 45519777 missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45517943 missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45517941 missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45518628 missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45518763 missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45518752 missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45521874 missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45517924 missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45516651 missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45490373 unclassified probably null
R6294:Tulp2 UTSW 7 45514692 missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45518588 missense probably benign 0.01
R6875:Tulp2 UTSW 7 45518614 missense probably benign 0.05
R7459:Tulp2 UTSW 7 45519803 missense probably damaging 1.00
R7676:Tulp2 UTSW 7 45521027 missense possibly damaging 0.86
R7966:Tulp2 UTSW 7 45516764 intron probably null
Z1088:Tulp2 UTSW 7 45521986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACGGTCTTACACAGATTATCC -3'
(R):5'- GGAGCAACACGTATGCTTCC -3'

Sequencing Primer
(F):5'- ACACAGATTATCCTATGGCTCTGTGG -3'
(R):5'- GAGCAACACGTATGCTTCCATGTC -3'
Posted On2019-10-18