Incidental Mutation 'R7558:1700093K21Rik'
ID586003
Institutional Source Beutler Lab
Gene Symbol 1700093K21Rik
Ensembl Gene ENSMUSG00000020286
Gene NameRIKEN cDNA 1700093K21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7558 (G1)
Quality Score173.009
Status Validated
Chromosome11
Chromosomal Location23516203-23521155 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to T at 23516285 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020527] [ENSMUST00000140122] [ENSMUST00000156629] [ENSMUST00000169264]
Predicted Effect probably null
Transcript: ENSMUST00000020527
SMART Domains Protein: ENSMUSP00000020527
Gene: ENSMUSG00000020286

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:DUF4642 50 196 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140122
Predicted Effect probably benign
Transcript: ENSMUST00000156629
Predicted Effect probably null
Transcript: ENSMUST00000169264
SMART Domains Protein: ENSMUSP00000131204
Gene: ENSMUSG00000020286

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:DUF4642 50 196 1.3e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit congenital heart defects associated with heterotaxy, as well as thoracic and abdominal visceral organ situs anomalies, and misaligned sternal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in 1700093K21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:1700093K21Rik APN 11 23517213 missense probably null 1.00
IGL02897:1700093K21Rik APN 11 23517308 missense probably benign 0.00
R1155:1700093K21Rik UTSW 11 23517270 missense possibly damaging 0.95
R1677:1700093K21Rik UTSW 11 23517357 missense probably benign 0.16
R3983:1700093K21Rik UTSW 11 23517220 missense possibly damaging 0.87
R5485:1700093K21Rik UTSW 11 23517378 missense probably benign 0.05
R5589:1700093K21Rik UTSW 11 23518066 missense probably benign 0.25
R5678:1700093K21Rik UTSW 11 23516529 missense probably damaging 1.00
R5783:1700093K21Rik UTSW 11 23518787 missense probably damaging 0.99
R5996:1700093K21Rik UTSW 11 23518928 start codon destroyed probably null 0.53
R6072:1700093K21Rik UTSW 11 23517357 missense probably benign 0.16
R6520:1700093K21Rik UTSW 11 23517285 missense possibly damaging 0.63
R6930:1700093K21Rik UTSW 11 23516563 missense probably benign 0.03
R7432:1700093K21Rik UTSW 11 23518839 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATGGTACCTGCAGCATGATC -3'
(R):5'- TCGAAGCTATGCTCGAGAAC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TCGAAGCTATGCTCGAGAACATAAG -3'
Posted On2019-10-18