Incidental Mutation 'R7562:Fancc'
List |< first << previous [record 28 of 71] next >> last >|
ID586010
Institutional Source Beutler Lab
Gene Symbol Fancc
Ensembl Gene ENSMUSG00000021461
Gene NameFanconi anemia, complementation group C
SynonymsFacc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location63285043-63497278 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 63403053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073029] [ENSMUST00000073029] [ENSMUST00000099444] [ENSMUST00000159024] [ENSMUST00000159024] [ENSMUST00000160617] [ENSMUST00000160931] [ENSMUST00000160931] [ENSMUST00000161977] [ENSMUST00000161977] [ENSMUST00000162375] [ENSMUST00000162375] [ENSMUST00000162971] [ENSMUST00000162971] [ENSMUST00000163091] [ENSMUST00000163091] [ENSMUST00000220684] [ENSMUST00000220684]
Predicted Effect probably null
Transcript: ENSMUST00000073029
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073029
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099444
SMART Domains Protein: ENSMUSP00000097043
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 461 5.8e-243 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159024
SMART Domains Protein: ENSMUSP00000124325
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 199 1.8e-117 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159024
SMART Domains Protein: ENSMUSP00000124325
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 199 1.8e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160617
Predicted Effect probably benign
Transcript: ENSMUST00000160735
SMART Domains Protein: ENSMUSP00000125710
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 91 5.1e-37 PFAM
Pfam:Fanconi_C 86 117 5.6e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160931
Predicted Effect probably null
Transcript: ENSMUST00000160931
Predicted Effect probably null
Transcript: ENSMUST00000161977
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161977
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162375
SMART Domains Protein: ENSMUSP00000124759
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 212 1.6e-125 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162375
SMART Domains Protein: ENSMUSP00000124759
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 212 1.6e-125 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162971
SMART Domains Protein: ENSMUSP00000123972
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 229 5.7e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162971
SMART Domains Protein: ENSMUSP00000123972
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 229 5.7e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163091
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163091
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220684
Predicted Effect probably null
Transcript: ENSMUST00000220684
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are grossly normal, but chromosome aberrations and sensitivity to DNA crosslinkers are seen. Both sexes have fewer germ cell numbers and impaired fertility. Marrow progenitors show decrease in colony forming ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Fancc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fancc APN 13 63400245 missense probably damaging 1.00
IGL00846:Fancc APN 13 63340456 missense possibly damaging 0.89
IGL01404:Fancc APN 13 63361638 missense probably damaging 1.00
IGL02592:Fancc APN 13 63360197 missense probably damaging 1.00
IGL02625:Fancc APN 13 63398151 missense probably damaging 0.99
canneloni UTSW 13 63331823 intron probably benign
macaroni UTSW 13 63321865 critical splice donor site probably null
R0362:Fancc UTSW 13 63398156 missense possibly damaging 0.86
R0554:Fancc UTSW 13 63317469 missense probably benign 0.32
R0626:Fancc UTSW 13 63317391 missense probably damaging 0.97
R0627:Fancc UTSW 13 63317478 missense probably damaging 0.99
R0726:Fancc UTSW 13 63323411 missense probably benign 0.01
R0734:Fancc UTSW 13 63331842 missense probably damaging 1.00
R1363:Fancc UTSW 13 63361598 missense probably damaging 1.00
R1587:Fancc UTSW 13 63340432 missense probably benign 0.32
R1922:Fancc UTSW 13 63330567 missense possibly damaging 0.89
R4585:Fancc UTSW 13 63347564 missense probably benign 0.14
R4586:Fancc UTSW 13 63347564 missense probably benign 0.14
R4608:Fancc UTSW 13 63331823 intron probably benign
R5159:Fancc UTSW 13 63321865 critical splice donor site probably null
R5401:Fancc UTSW 13 63402953 missense probably damaging 1.00
R5561:Fancc UTSW 13 63317387 missense possibly damaging 0.85
R5699:Fancc UTSW 13 63330632 splice site probably null
R6200:Fancc UTSW 13 63360248 missense probably damaging 1.00
R6448:Fancc UTSW 13 63340428 missense probably damaging 0.98
R7615:Fancc UTSW 13 63317558 critical splice acceptor site probably null
R7805:Fancc UTSW 13 63360242 missense possibly damaging 0.86
R7864:Fancc UTSW 13 63400259 nonsense probably null
R7947:Fancc UTSW 13 63400259 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATCTGCCTCAGGAACTCC -3'
(R):5'- GAGTTCCTGTGGAAGTGTAAGGAC -3'

Sequencing Primer
(F):5'- TCCTGGAACCCGGACAAGTG -3'
(R):5'- TGGAAGTGTAAGGACTTTTAGTAACG -3'
Posted On2019-10-18