Incidental Mutation 'R7568:Dhtkd1'
ID586019
Institutional Source Beutler Lab
Gene Symbol Dhtkd1
Ensembl Gene ENSMUSG00000025815
Gene Namedehydrogenase E1 and transketolase domain containing 1
SynonymsC330018I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7568 (G1)
Quality Score101.013
Status Not validated
Chromosome2
Chromosomal Location5896115-5942792 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 5922087 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000095147]
Predicted Effect probably null
Transcript: ENSMUST00000026924
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000095147
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik T C 16: 38,828,447 E100G possibly damaging Het
Actbl2 T A 13: 111,255,422 V97E possibly damaging Het
Actl7a A T 4: 56,744,498 T342S probably damaging Het
Alcam A G 16: 52,268,386 S554P probably damaging Het
Ano3 T C 2: 110,950,293 probably benign Het
Atad2b T A 12: 5,010,390 probably null Het
Baz2a T C 10: 128,125,270 S1621P possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG 3: 95,888,151 probably benign Het
BC028528 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT 3: 95,888,172 probably benign Het
Best1 T A 19: 9,989,275 probably null Het
Catip G T 1: 74,368,930 E474* probably null Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crebbp G A 16: 4,126,489 R600W probably benign Het
Cyfip1 A G 7: 55,872,249 probably null Het
Ddr1 A G 17: 35,684,282 S675P probably damaging Het
F2rl1 G A 13: 95,514,014 A120V probably damaging Het
Fam136a A G 6: 86,365,802 N24D probably benign Het
Fbxw10 C A 11: 62,875,168 Q755K probably benign Het
Fbxw16 C A 9: 109,439,589 Q244H possibly damaging Het
Gabrg2 T C 11: 41,916,292 K373E probably benign Het
Herc3 G A 6: 58,843,810 V60I probably benign Het
Igkv19-93 T A 6: 68,736,493 K51* probably null Het
Krt23 T A 11: 99,492,800 K89* probably null Het
Mavs A G 2: 131,245,475 T298A probably benign Het
Mlec T C 5: 115,150,122 Y198C probably damaging Het
Ncam2 C A 16: 81,589,801 N689K probably benign Het
Nfkbia A G 12: 55,491,761 I82T probably damaging Het
Olfr104-ps A G 17: 37,362,605 I163V probably benign Het
Olfr1351 A T 10: 79,017,507 I62F probably benign Het
Olfr527 A G 7: 140,335,982 N40S probably damaging Het
Olfr902 A G 9: 38,449,646 Y258C probably damaging Het
Pom121l2 A T 13: 21,982,626 I356F probably benign Het
Ppip5k1 A T 2: 121,337,615 L719Q probably damaging Het
Satb1 A T 17: 51,782,724 V365D possibly damaging Het
Scrn2 T C 11: 97,030,886 Y61H probably damaging Het
Siglec1 C T 2: 131,072,682 V1505M probably damaging Het
Slc2a10 A G 2: 165,514,882 N154S probably damaging Het
Slc39a10 A T 1: 46,835,130 H337Q probably benign Het
Slc39a12 T A 2: 14,400,128 probably null Het
Slc6a6 T G 6: 91,724,851 L80R probably damaging Het
Slit1 T C 19: 41,601,635 Y1404C probably damaging Het
Sowahc A G 10: 59,223,299 E419G probably damaging Het
Ssh1 T C 5: 113,957,380 probably null Het
Stab1 C A 14: 31,152,595 C952F probably damaging Het
Stat5a T C 11: 100,875,024 M312T possibly damaging Het
Tex2 A G 11: 106,548,736 I606T unknown Het
Vmn1r19 A G 6: 57,404,828 H122R possibly damaging Het
Zfp959 A G 17: 55,897,886 I308V probably benign Het
Other mutations in Dhtkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Dhtkd1 APN 2 5929657 missense probably damaging 1.00
IGL01544:Dhtkd1 APN 2 5913531 missense probably benign 0.00
IGL01724:Dhtkd1 APN 2 5914840 missense probably benign 0.00
IGL01726:Dhtkd1 APN 2 5942656 missense unknown
IGL02069:Dhtkd1 APN 2 5930934 nonsense probably null 0.00
IGL02476:Dhtkd1 APN 2 5930906 missense possibly damaging 0.89
IGL02662:Dhtkd1 APN 2 5899972 missense probably damaging 1.00
IGL02937:Dhtkd1 APN 2 5917905 missense possibly damaging 0.49
PIT4486001:Dhtkd1 UTSW 2 5899995 missense probably benign
R0277:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0323:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0373:Dhtkd1 UTSW 2 5911870 missense probably damaging 1.00
R0512:Dhtkd1 UTSW 2 5904091 missense probably damaging 1.00
R1497:Dhtkd1 UTSW 2 5904113 missense probably damaging 1.00
R1924:Dhtkd1 UTSW 2 5911933 missense probably damaging 1.00
R1943:Dhtkd1 UTSW 2 5932482 missense probably benign 0.11
R1976:Dhtkd1 UTSW 2 5902391 missense possibly damaging 0.95
R2057:Dhtkd1 UTSW 2 5942619 missense unknown
R5050:Dhtkd1 UTSW 2 5917689 missense probably benign 0.00
R5057:Dhtkd1 UTSW 2 5919513 missense probably damaging 1.00
R5133:Dhtkd1 UTSW 2 5904002 missense probably damaging 1.00
R5219:Dhtkd1 UTSW 2 5914816 missense probably benign 0.01
R5437:Dhtkd1 UTSW 2 5924119 missense probably benign 0.01
R5526:Dhtkd1 UTSW 2 5911851 missense probably damaging 1.00
R5720:Dhtkd1 UTSW 2 5903014 missense probably damaging 1.00
R6006:Dhtkd1 UTSW 2 5904025 nonsense probably null
R6155:Dhtkd1 UTSW 2 5910359 missense probably null 1.00
R6675:Dhtkd1 UTSW 2 5904078 missense probably damaging 1.00
R6870:Dhtkd1 UTSW 2 5919437 splice site probably null
R6899:Dhtkd1 UTSW 2 5917965 missense possibly damaging 0.91
R7123:Dhtkd1 UTSW 2 5917780 missense probably damaging 0.99
R7131:Dhtkd1 UTSW 2 5904070 missense probably benign 0.23
R7366:Dhtkd1 UTSW 2 5917906 missense probably benign 0.01
R7731:Dhtkd1 UTSW 2 5924112 missense probably benign 0.07
R7874:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
R7957:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
Z1088:Dhtkd1 UTSW 2 5911874 missense possibly damaging 0.84
Z1177:Dhtkd1 UTSW 2 5942628 missense unknown
Predicted Primers PCR Primer
(F):5'- GACCTGGAACGTTCATCCC -3'
(R):5'- TCTGTTTTCATGCAGAATTTCCTAG -3'

Sequencing Primer
(F):5'- TGCGTGAGAATCCCAACG -3'
(R):5'- TTCCTAGAGCTGAAACTGGC -3'
Posted On2019-10-18