Incidental Mutation 'R7568:Slc39a12'
ID586020
Institutional Source Beutler Lab
Gene Symbol Slc39a12
Ensembl Gene ENSMUSG00000036949
Gene Namesolute carrier family 39 (zinc transporter), member 12
SynonymsLOC277468
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7568 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location14388316-14494977 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 14400128 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082290] [ENSMUST00000114731]
Predicted Effect probably null
Transcript: ENSMUST00000082290
SMART Domains Protein: ENSMUSP00000080911
Gene: ENSMUSG00000036949

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zip 364 681 1.8e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114731
SMART Domains Protein: ENSMUSP00000110379
Gene: ENSMUSG00000036949

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Zip 382 511 2.5e-17 PFAM
Pfam:Zip 492 661 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik T C 16: 38,828,447 E100G possibly damaging Het
Actbl2 T A 13: 111,255,422 V97E possibly damaging Het
Actl7a A T 4: 56,744,498 T342S probably damaging Het
Alcam A G 16: 52,268,386 S554P probably damaging Het
Ano3 T C 2: 110,950,293 probably benign Het
Atad2b T A 12: 5,010,390 probably null Het
Baz2a T C 10: 128,125,270 S1621P possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG 3: 95,888,151 probably benign Het
BC028528 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT 3: 95,888,172 probably benign Het
Best1 T A 19: 9,989,275 probably null Het
Catip G T 1: 74,368,930 E474* probably null Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crebbp G A 16: 4,126,489 R600W probably benign Het
Cyfip1 A G 7: 55,872,249 probably null Het
Ddr1 A G 17: 35,684,282 S675P probably damaging Het
Dhtkd1 A T 2: 5,922,087 probably null Het
F2rl1 G A 13: 95,514,014 A120V probably damaging Het
Fam136a A G 6: 86,365,802 N24D probably benign Het
Fbxw10 C A 11: 62,875,168 Q755K probably benign Het
Fbxw16 C A 9: 109,439,589 Q244H possibly damaging Het
Gabrg2 T C 11: 41,916,292 K373E probably benign Het
Herc3 G A 6: 58,843,810 V60I probably benign Het
Igkv19-93 T A 6: 68,736,493 K51* probably null Het
Krt23 T A 11: 99,492,800 K89* probably null Het
Mavs A G 2: 131,245,475 T298A probably benign Het
Mlec T C 5: 115,150,122 Y198C probably damaging Het
Ncam2 C A 16: 81,589,801 N689K probably benign Het
Nfkbia A G 12: 55,491,761 I82T probably damaging Het
Olfr104-ps A G 17: 37,362,605 I163V probably benign Het
Olfr1351 A T 10: 79,017,507 I62F probably benign Het
Olfr527 A G 7: 140,335,982 N40S probably damaging Het
Olfr902 A G 9: 38,449,646 Y258C probably damaging Het
Pom121l2 A T 13: 21,982,626 I356F probably benign Het
Ppip5k1 A T 2: 121,337,615 L719Q probably damaging Het
Satb1 A T 17: 51,782,724 V365D possibly damaging Het
Scrn2 T C 11: 97,030,886 Y61H probably damaging Het
Siglec1 C T 2: 131,072,682 V1505M probably damaging Het
Slc2a10 A G 2: 165,514,882 N154S probably damaging Het
Slc39a10 A T 1: 46,835,130 H337Q probably benign Het
Slc6a6 T G 6: 91,724,851 L80R probably damaging Het
Slit1 T C 19: 41,601,635 Y1404C probably damaging Het
Sowahc A G 10: 59,223,299 E419G probably damaging Het
Ssh1 T C 5: 113,957,380 probably null Het
Stab1 C A 14: 31,152,595 C952F probably damaging Het
Stat5a T C 11: 100,875,024 M312T possibly damaging Het
Tex2 A G 11: 106,548,736 I606T unknown Het
Vmn1r19 A G 6: 57,404,828 H122R possibly damaging Het
Zfp959 A G 17: 55,897,886 I308V probably benign Het
Other mutations in Slc39a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Slc39a12 APN 2 14396068 splice site probably benign
IGL01597:Slc39a12 APN 2 14434309 missense possibly damaging 0.95
IGL02516:Slc39a12 APN 2 14400335 missense probably damaging 1.00
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0453:Slc39a12 UTSW 2 14435681 missense probably benign 0.04
R0533:Slc39a12 UTSW 2 14400331 missense probably benign 0.00
R0718:Slc39a12 UTSW 2 14407426 splice site probably benign
R1647:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1648:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1879:Slc39a12 UTSW 2 14444057 missense probably benign
R1993:Slc39a12 UTSW 2 14434219 missense probably damaging 0.98
R2429:Slc39a12 UTSW 2 14405086 missense probably benign 0.06
R3746:Slc39a12 UTSW 2 14396067 splice site probably benign
R3934:Slc39a12 UTSW 2 14434363 splice site probably benign
R3941:Slc39a12 UTSW 2 14396181 missense possibly damaging 0.95
R4008:Slc39a12 UTSW 2 14452117 missense probably damaging 1.00
R4478:Slc39a12 UTSW 2 14420179 nonsense probably null
R4622:Slc39a12 UTSW 2 14400325 missense probably benign 0.11
R4760:Slc39a12 UTSW 2 14400323 missense probably benign 0.14
R5477:Slc39a12 UTSW 2 14389382 missense possibly damaging 0.46
R5566:Slc39a12 UTSW 2 14407603 missense possibly damaging 0.80
R5725:Slc39a12 UTSW 2 14389264 start gained probably benign
R5798:Slc39a12 UTSW 2 14449826 missense probably damaging 1.00
R6074:Slc39a12 UTSW 2 14407479 nonsense probably null
R6169:Slc39a12 UTSW 2 14400233 missense possibly damaging 0.64
R6180:Slc39a12 UTSW 2 14396127 missense probably benign 0.38
R6802:Slc39a12 UTSW 2 14420085 missense probably benign 0.28
R6847:Slc39a12 UTSW 2 14449917 missense probably damaging 1.00
R6899:Slc39a12 UTSW 2 14389541 missense probably damaging 1.00
R6931:Slc39a12 UTSW 2 14389375 missense probably benign 0.04
R7131:Slc39a12 UTSW 2 14449803 missense probably damaging 1.00
R7343:Slc39a12 UTSW 2 14452000 missense probably damaging 1.00
R7525:Slc39a12 UTSW 2 14494461 missense probably benign 0.01
R7684:Slc39a12 UTSW 2 14449859 missense probably damaging 0.99
R7761:Slc39a12 UTSW 2 14434330 missense probably benign 0.01
R7785:Slc39a12 UTSW 2 14420218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCAAGCTATGAGTGGGC -3'
(R):5'- CTGTAAAATCATCTGGAGAAGGC -3'

Sequencing Primer
(F):5'- AGTGGGCATGCACTTCAG -3'
(R):5'- GAGAAGGCAAGGCTTTTCTTCCC -3'
Posted On2019-10-18