Incidental Mutation 'R7319:Sh3bp4'
ID 586048
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 045415-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7319 (G1)
Quality Score 156.008
Status Validated
Chromosome 1
Chromosomal Location 88998137-89082790 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 89080824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably null
Transcript: ENSMUST00000066279
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,393,635 (GRCm39) I287N probably benign Het
Aco2 G T 15: 81,787,820 (GRCm39) E223D probably damaging Het
Acsf3 T A 8: 123,539,770 (GRCm39) I466N probably damaging Het
Albfm1 G A 5: 90,719,625 (GRCm39) probably null Het
Aox3 T A 1: 58,191,761 (GRCm39) F438I probably benign Het
Arhgap33 T C 7: 30,225,794 (GRCm39) T591A probably benign Het
Ash1l C T 3: 88,888,694 (GRCm39) A191V probably benign Het
Btg2 T C 1: 134,006,779 (GRCm39) K5E probably benign Het
C1galt1 T A 6: 7,871,150 (GRCm39) Y329N probably damaging Het
Cacna1h A G 17: 25,608,435 (GRCm39) I824T possibly damaging Het
Carmil3 A G 14: 55,731,817 (GRCm39) I182V probably benign Het
Ccdc150 T A 1: 54,302,496 (GRCm39) probably null Het
Chek1 T A 9: 36,633,939 (GRCm39) R129W probably damaging Het
Chrna6 A G 8: 27,896,815 (GRCm39) M354T possibly damaging Het
Cpq A G 15: 33,250,185 (GRCm39) T181A probably benign Het
Csmd2 A T 4: 128,287,472 (GRCm39) Y1069F Het
Defb28 T A 2: 152,361,974 (GRCm39) C45S possibly damaging Het
Dnah1 A G 14: 31,018,551 (GRCm39) Y1360H probably benign Het
Dnah7c T C 1: 46,823,608 (GRCm39) V3749A possibly damaging Het
Dnah7c T A 1: 46,819,935 (GRCm39) D3728E probably benign Het
Dym G A 18: 75,196,245 (GRCm39) probably null Het
Dync2i2 G A 2: 29,928,341 (GRCm39) P95L probably benign Het
Dzip3 A G 16: 48,747,903 (GRCm39) probably null Het
Eef1akmt4 A G 16: 20,436,666 (GRCm39) K163E probably benign Het
Fbrs A G 7: 127,081,985 (GRCm39) T242A possibly damaging Het
Fgfr3 G A 5: 33,885,146 (GRCm39) V87M possibly damaging Het
Fst A T 13: 114,595,068 (GRCm39) C19S probably benign Het
Gm7276 G A 18: 77,273,216 (GRCm39) R173W unknown Het
Gm9195 G A 14: 72,697,929 (GRCm39) H1284Y probably benign Het
Herc6 C A 6: 57,581,074 (GRCm39) T258K probably damaging Het
Hip1r A G 5: 124,137,174 (GRCm39) Y678C probably damaging Het
Ifne A T 4: 88,798,243 (GRCm39) N58K probably damaging Het
Ighv1-26 A T 12: 114,752,163 (GRCm39) H60Q possibly damaging Het
Ints1 A G 5: 139,746,520 (GRCm39) F1276L probably damaging Het
Itprid2 A T 2: 79,466,416 (GRCm39) D82V probably damaging Het
Kcnc4 T A 3: 107,366,100 (GRCm39) E36V probably benign Het
Kcnq2 C T 2: 180,750,895 (GRCm39) G315S probably damaging Het
Kdm4c G A 4: 74,255,200 (GRCm39) V585M probably damaging Het
Klhl26 C T 8: 70,905,592 (GRCm39) R106H probably damaging Het
Kmo T C 1: 175,481,221 (GRCm39) F313S probably damaging Het
Lmtk3 T A 7: 45,443,740 (GRCm39) S808T unknown Het
Lrch3 A G 16: 32,815,363 (GRCm39) T585A probably benign Het
Lrch4 T A 5: 137,637,977 (GRCm39) H86Q Het
Map3k20 A G 2: 72,195,062 (GRCm39) D113G probably damaging Het
Mbd3l1 T C 9: 18,396,417 (GRCm39) S181P probably benign Het
Mccc2 T C 13: 100,104,241 (GRCm39) T303A probably benign Het
Med27 A G 2: 29,303,490 (GRCm39) R147G possibly damaging Het
Mrps5 T A 2: 127,437,762 (GRCm39) S196R possibly damaging Het
Muc21 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,932,935 (GRCm39) probably benign Het
Myo16 A T 8: 10,526,185 (GRCm39) probably null Het
Nudt2 A T 4: 41,477,575 (GRCm39) M19L probably benign Het
Pcdha11 C T 18: 37,146,245 (GRCm39) P779S probably benign Het
Phykpl A G 11: 51,489,530 (GRCm39) T379A probably benign Het
Plekha8 A C 6: 54,601,206 (GRCm39) M270L probably benign Het
Plekhg5 A G 4: 152,192,885 (GRCm39) H593R probably benign Het
Polr2a T C 11: 69,637,196 (GRCm39) N293S possibly damaging Het
Pramel32 G A 4: 88,548,184 (GRCm39) P74S probably benign Het
Prex2 T A 1: 11,232,532 (GRCm39) N866K probably benign Het
Psme4 A T 11: 30,757,790 (GRCm39) I308L probably benign Het
Ptprb T C 10: 116,177,309 (GRCm39) V1003A probably benign Het
Rbbp8 T A 18: 11,865,269 (GRCm39) D719E probably damaging Het
Rnaset2b A T 17: 7,259,166 (GRCm39) D144V probably benign Het
Senp6 T G 9: 80,033,481 (GRCm39) D662E probably damaging Het
Serpinb3c T C 1: 107,200,817 (GRCm39) N200S possibly damaging Het
Serpinb9g C G 13: 33,672,543 (GRCm39) Y113* probably null Het
Sgf29 T C 7: 126,270,821 (GRCm39) I134T probably benign Het
Stab1 G A 14: 30,862,783 (GRCm39) L2243F probably damaging Het
Sympk T C 7: 18,769,770 (GRCm39) V149A probably benign Het
Syt3 C T 7: 44,041,953 (GRCm39) Q271* probably null Het
Tas2r109 A G 6: 132,957,663 (GRCm39) I89T probably benign Het
Tgif1 A G 17: 71,151,847 (GRCm39) S255P probably damaging Het
Tm9sf1 G A 14: 55,875,432 (GRCm39) probably benign Het
Tnf A G 17: 35,419,347 (GRCm39) F161S possibly damaging Het
Topaz1 T A 9: 122,579,428 (GRCm39) S779R possibly damaging Het
Topors A G 4: 40,260,540 (GRCm39) S915P unknown Het
Tpm4 C T 8: 72,900,321 (GRCm39) L161F probably damaging Het
Trim38 C T 13: 23,975,384 (GRCm39) T441I probably damaging Het
Trpv1 A G 11: 73,141,620 (GRCm39) M548V probably benign Het
Vmn2r68 T A 7: 84,883,042 (GRCm39) T237S probably benign Het
Zc3hav1 A G 6: 38,309,209 (GRCm39) S538P probably benign Het
Zfp541 C T 7: 15,813,294 (GRCm39) T649I probably benign Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89,071,682 (GRCm39) missense probably benign
IGL01344:Sh3bp4 APN 1 89,080,958 (GRCm39) missense probably benign
IGL02025:Sh3bp4 APN 1 89,073,008 (GRCm39) missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89,071,412 (GRCm39) missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89,072,870 (GRCm39) missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89,080,885 (GRCm39) missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89,071,266 (GRCm39) splice site probably benign
IGL03327:Sh3bp4 APN 1 89,071,885 (GRCm39) nonsense probably null
I0000:Sh3bp4 UTSW 1 89,065,518 (GRCm39) missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89,073,156 (GRCm39) missense probably benign
R0128:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89,071,494 (GRCm39) missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89,073,210 (GRCm39) missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89,073,314 (GRCm39) missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89,073,050 (GRCm39) missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89,073,591 (GRCm39) missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89,071,995 (GRCm39) missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89,073,317 (GRCm39) missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89,071,962 (GRCm39) missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89,065,456 (GRCm39) missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89,071,997 (GRCm39) missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89,073,072 (GRCm39) missense probably benign
R5908:Sh3bp4 UTSW 1 89,073,605 (GRCm39) missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89,073,211 (GRCm39) missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89,072,643 (GRCm39) missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89,080,888 (GRCm39) missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89,073,489 (GRCm39) missense probably benign 0.00
R7320:Sh3bp4 UTSW 1 89,073,216 (GRCm39) missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89,072,170 (GRCm39) missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89,073,368 (GRCm39) missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89,073,037 (GRCm39) missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89,073,297 (GRCm39) missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89,080,064 (GRCm39) missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89,072,159 (GRCm39) missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89,072,647 (GRCm39) nonsense probably null
R9718:Sh3bp4 UTSW 1 89,073,472 (GRCm39) missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89,072,744 (GRCm39) missense probably benign
Z1176:Sh3bp4 UTSW 1 89,073,450 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATGGGCAGTTTCTGATACACGG -3'
(R):5'- AGGATCAGTGTCCCTGTGAG -3'

Sequencing Primer
(F):5'- CAGTTTCTGATACACGGCACGG -3'
(R):5'- TCCCTGTGAGGTGCTTCCAG -3'
Posted On 2019-10-23