Incidental Mutation 'R0620:Mtss1l'
ID 58606
Institutional Source Beutler Lab
Gene Symbol Mtss1l
Ensembl Gene ENSMUSG00000033763
Gene Name metastasis suppressor 1-like
Synonyms ABBA
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0620 (G1)
Quality Score 216
Status Validated
Chromosome 8
Chromosomal Location 110721476-110741400 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110737948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 322 (P322S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000076846] [ENSMUST00000144041] [ENSMUST00000150680]
AlphaFold Q6P9S0
Predicted Effect probably benign
Transcript: ENSMUST00000052457
AA Change: P405S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763
AA Change: P405S

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076846
SMART Domains Protein: ENSMUSP00000076120
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 28 184 2e-79 PFAM
low complexity region 219 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133848
Predicted Effect probably damaging
Transcript: ENSMUST00000141302
AA Change: P322S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763
AA Change: P322S

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144041
AA Change: P343S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763
AA Change: P343S

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149273
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150680
SMART Domains Protein: ENSMUSP00000114398
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 23 155 4.6e-64 PFAM
low complexity region 197 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154803
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Mtss1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02124:Mtss1l APN 8 110737624 missense probably damaging 1.00
R0685:Mtss1l UTSW 8 110727397 critical splice donor site probably null
R2082:Mtss1l UTSW 8 110726257 critical splice donor site probably null
R2149:Mtss1l UTSW 8 110726383 missense possibly damaging 0.58
R2266:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2267:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2269:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2378:Mtss1l UTSW 8 110738349 missense probably damaging 1.00
R3756:Mtss1l UTSW 8 110730060 missense probably damaging 1.00
R4005:Mtss1l UTSW 8 110739041 frame shift probably null
R4552:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4553:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4849:Mtss1l UTSW 8 110726243 missense possibly damaging 0.92
R5212:Mtss1l UTSW 8 110729218 missense probably damaging 1.00
R6294:Mtss1l UTSW 8 110727328 missense possibly damaging 0.89
R6336:Mtss1l UTSW 8 110732164 missense probably damaging 1.00
R7090:Mtss1l UTSW 8 110730024 missense probably damaging 1.00
R7580:Mtss1l UTSW 8 110737636 missense possibly damaging 0.95
R7581:Mtss1l UTSW 8 110726213 missense possibly damaging 0.92
R7810:Mtss1l UTSW 8 110726201 missense probably damaging 0.99
R8497:Mtss1l UTSW 8 110738590 missense possibly damaging 0.95
R9033:Mtss1l UTSW 8 110739019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCACTCCAGGGTCAATGCCAG -3'
(R):5'- GCATCCCCATTCACAGAGTAGCAG -3'

Sequencing Primer
(F):5'- GACATGGAGAGTGAGGCTTT -3'
(R):5'- TTCACAGAGTAGCAGTCGTAGTC -3'
Posted On 2013-07-11