Incidental Mutation 'R7572:Orc4'
ID586061
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48910236 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 300 (M300K)
Ref Sequence ENSEMBL: ENSMUSP00000028098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098]
Predicted Effect probably benign
Transcript: ENSMUST00000028098
AA Change: M300K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: M300K

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
R7938:Orc4 UTSW 2 48910191 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGTGGTATGGGATGCAGAACAC -3'
(R):5'- GCATCTGAACTAAGTCATTGCTAC -3'

Sequencing Primer
(F):5'- TATGGGATGCAGAACACAAAGAG -3'
(R):5'- CATTTTCATGGAGCAAAGTTTAAGG -3'
Posted On2019-10-24