Incidental Mutation 'R7572:Ciao1'
ID586063
Institutional Source Beutler Lab
Gene Symbol Ciao1
Ensembl Gene ENSMUSG00000003662
Gene Namecytosolic iron-sulfur protein assembly 1
SynonymsWdr39
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127240938-127247816 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 127246711 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 97 (C97*)
Ref Sequence ENSEMBL: ENSMUSP00000003759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003759] [ENSMUST00000035871] [ENSMUST00000172636] [ENSMUST00000174030] [ENSMUST00000174288] [ENSMUST00000174503] [ENSMUST00000174863]
Predicted Effect probably null
Transcript: ENSMUST00000003759
AA Change: C97*
SMART Domains Protein: ENSMUSP00000003759
Gene: ENSMUSG00000003662
AA Change: C97*

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
WD40 240 280 8.04e-4 SMART
WD40 291 332 5.26e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035871
SMART Domains Protein: ENSMUSP00000035434
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 179 3e-98 BLAST
low complexity region 202 216 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172636
AA Change: C48S
SMART Domains Protein: ENSMUSP00000134199
Gene: ENSMUSG00000003662
AA Change: C48S

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174030
AA Change: C97*
SMART Domains Protein: ENSMUSP00000134189
Gene: ENSMUSG00000003662
AA Change: C97*

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174288
SMART Domains Protein: ENSMUSP00000134629
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
Blast:Sec63 1 95 1e-60 BLAST
low complexity region 118 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174503
SMART Domains Protein: ENSMUSP00000133701
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 124 8e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000174863
AA Change: C97*
SMART Domains Protein: ENSMUSP00000134159
Gene: ENSMUSG00000003662
AA Change: C97*

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 176 1.38e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Ciao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Ciao1 APN 2 127242835 missense probably benign
R1662:Ciao1 UTSW 2 127244937 missense probably benign 0.01
R1703:Ciao1 UTSW 2 127245819 missense probably benign 0.37
R1935:Ciao1 UTSW 2 127246460 missense possibly damaging 0.95
R1940:Ciao1 UTSW 2 127246460 missense possibly damaging 0.95
R2427:Ciao1 UTSW 2 127246691 missense probably damaging 1.00
R5891:Ciao1 UTSW 2 127247134 missense probably benign 0.08
R6295:Ciao1 UTSW 2 127246456 missense probably damaging 1.00
R6388:Ciao1 UTSW 2 127246476 nonsense probably null
R7211:Ciao1 UTSW 2 127247008 critical splice donor site probably null
R7448:Ciao1 UTSW 2 127245758 missense probably damaging 0.99
R8145:Ciao1 UTSW 2 127245806 missense possibly damaging 0.90
R8245:Ciao1 UTSW 2 127246484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTCAGGGACAAAGCTG -3'
(R):5'- GGCTTGGTCATATTAGTTACAGCC -3'

Sequencing Primer
(F):5'- CTGAAAGCCAGCGAGCTG -3'
(R):5'- GTTCATGACTGTAATGCCAGC -3'
Posted On2019-10-24