Mutagenetix > Incidental Mutation

Incidental Mutation 'R7572:Zc3h6'

586064

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

045658-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R7572 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129017252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1068 (K1068E)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110320
AA Change: K1068E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: K1068E

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

95% (56/59)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,679	T57S	possibly damaging	Het
Adamts1	A	G	16: 85,797,741	Y670H	possibly damaging	Het
Akr1b7	A	T	6: 34,419,408	I185F	probably damaging	Het
Ankfn1	T	C	11: 89,421,271	N683D	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Chrna5	T	A	9: 55,006,465	W432R	probably damaging	Het
Chrng	T	A	1: 87,209,114	L235Q	probably damaging	Het
Ciao1	A	T	2: 127,246,711	C97*	probably null	Het
Cpt2	G	T	4: 107,907,548	H340N	probably damaging	Het
Dmtn	A	T	14: 70,605,337	M328K	possibly damaging	Het
Dusp10	T	A	1: 184,074,309	V413E	probably damaging	Het
Epha3	A	T	16: 63,611,080	L487*	probably null	Het
Esco2	A	G	14: 65,831,192	V223A	probably damaging	Het
Fryl	A	T	5: 73,088,396	D1139E	possibly damaging	Het
Gemin4	A	G	11: 76,213,582	S118P	probably damaging	Het
Gm16486	T	C	8: 70,709,426	S423P	probably benign	Het
Gm3604	A	G	13: 62,370,246	I79T	probably damaging	Het
Gpatch3	T	C	4: 133,574,806	V16A	probably benign	Het
Hcn4	A	G	9: 58,823,780	N90S	unknown	Het
Hr	C	T	14: 70,561,853	H593Y	possibly damaging	Het
Igkv4-50	A	G	6: 69,700,967	V51A	probably damaging	Het
Insr	C	A	8: 3,173,602	V844F	probably benign	Het
Kcns2	T	C	15: 34,839,172	F227S	possibly damaging	Het
Map4k1	A	G	7: 28,987,138	I162V	probably benign	Het
Naip2	T	C	13: 100,154,960	S1157G	probably benign	Het
Neurog2	A	G	3: 127,633,901	E58G	probably damaging	Het
Olfr1269	T	C	2: 90,118,743	Y285C	probably damaging	Het
Olfr193	T	A	16: 59,110,430	Y60F	probably damaging	Het
Olfr868	T	G	9: 20,100,858	L33W	probably damaging	Het
Orc4	A	T	2: 48,910,236	M300K	probably benign	Het
Plch1	T	C	3: 63,740,684	D422G	possibly damaging	Het
Prox1	T	C	1: 190,123,386	E683G	probably benign	Het
Pxdn	A	G	12: 30,006,705	D1305G	probably damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rex2	T	G	4: 147,057,872	I272M	probably damaging	Het
Rpa2	T	C	4: 132,768,703	S12P	possibly damaging	Het
Samd15	C	A	12: 87,201,576	P345Q	probably damaging	Het
Sema5a	T	A	15: 32,673,428	I804N	probably damaging	Het
Sgsm3	G	A	15: 81,007,466	R165H	possibly damaging	Het
Slc22a30	T	G	19: 8,335,708	M467L	unknown	Het
Slc2a5	T	C	4: 150,142,185	I368T	probably benign	Het
Slc8a1	A	T	17: 81,441,771		probably null	Het
Snap91	T	C	9: 86,806,494	T331A	possibly damaging	Het
Soat2	G	T	15: 102,154,021		probably null	Het
Sptbn4	C	A	7: 27,372,272	R1589L	probably damaging	Het
Stk38l	A	G	6: 146,775,654	Y443C	probably damaging	Het
Sult5a1	T	C	8: 123,145,378	I242V	probably benign	Het
Susd3	T	C	13: 49,231,162	R262G	probably benign	Het
Syt9	A	G	7: 107,436,577	D267G	probably damaging	Het
Tbce	A	G	13: 14,010,587	V172A	probably benign	Het
Tcstv3	A	T	13: 120,317,571	D2V	possibly damaging	Het
Tmod1	T	A	4: 46,083,593	S7R	possibly damaging	Het
Ubqln4	C	T	3: 88,555,424		probably benign	Het
Ucp2	T	C	7: 100,497,307		probably null	Het
Usp30	G	A	5: 114,120,247	S306N	probably benign	Het
Usp5	A	T	6: 124,818,007	I660N	probably damaging	Het
Vmn1r43	A	G	6: 89,869,565	V313A	possibly damaging	Het
Wdr49	T	C	3: 75,358,437	H234R	possibly damaging	Het
Wdr70	T	C	15: 8,035,846	D245G	possibly damaging	Het
Zfp141	T	C	7: 42,475,432	K539E	probably benign	Het
Zfp758	T	A	17: 22,374,891	H119Q	possibly damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCACAGTCCTCAACAGCAG -3'
(R):5'- TGCCTTGGATCACTGTATGG -3'

Sequencing Primer
(F):5'- CTCAACAGCAGCACCTATTAATGTTG -3'
(R):5'- TCACTGTATGGAGGTCTAAGTAAGCC -3'

Posted On

2019-10-24