Incidental Mutation 'R7572:Tmod1'
ID586068
Institutional Source Beutler Lab
Gene Symbol Tmod1
Ensembl Gene ENSMUSG00000028328
Gene Nametropomodulin 1
Synonymserythrocyte tropomodulin, E-Tmod
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46038935-46116032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46083593 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 7 (S7R)
Ref Sequence ENSEMBL: ENSMUSP00000134075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107773] [ENSMUST00000156200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107773
AA Change: S109R

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328
AA Change: S109R

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156200
AA Change: S7R

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1403 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this locus results in aborted heart development and consequent embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Tmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Tmod1 APN 4 46096999 missense probably damaging 1.00
R1445:Tmod1 UTSW 4 46090884 missense probably damaging 1.00
R1513:Tmod1 UTSW 4 46083549 missense possibly damaging 0.61
R1888:Tmod1 UTSW 4 46097069 synonymous silent
R1980:Tmod1 UTSW 4 46061043 missense probably damaging 1.00
R2914:Tmod1 UTSW 4 46092259 missense probably damaging 1.00
R3725:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3726:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3952:Tmod1 UTSW 4 46078315 missense probably damaging 0.98
R4854:Tmod1 UTSW 4 46090920 missense possibly damaging 0.80
R4989:Tmod1 UTSW 4 46090872 missense probably damaging 0.97
R6254:Tmod1 UTSW 4 46078469 splice site probably null
R7212:Tmod1 UTSW 4 46093951 nonsense probably null
R7570:Tmod1 UTSW 4 46083632 missense probably benign 0.15
Z1176:Tmod1 UTSW 4 46092271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTAGGTTGCACTCTGCTC -3'
(R):5'- TCTCACGGTAACAACAGGTGG -3'

Sequencing Primer
(F):5'- TCACTTCTATCCCTTAATAATCTGGG -3'
(R):5'- AACAACAGGTGGTTTTGTGACC -3'
Posted On2019-10-24