Incidental Mutation 'R7572:Usp30'
ID586075
Institutional Source Beutler Lab
Gene Symbol Usp30
Ensembl Gene ENSMUSG00000029592
Gene Nameubiquitin specific peptidase 30
SynonymsD5Ertd483e, 6330590F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114065461-114124720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114120247 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 306 (S306N)
Ref Sequence ENSEMBL: ENSMUSP00000031588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000200119]
Predicted Effect probably benign
Transcript: ENSMUST00000031588
AA Change: S306N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053657
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112279
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200119
AA Change: S305N

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592
AA Change: S305N

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] USP30, a member of the ubiquitin-specific protease family (see USP1, MIM 603478), is a novel mitochondrial deubiquitinating (DUB) enzyme (Nakamura and Hirose, 2008 [PubMed 18287522]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Usp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Usp30 APN 5 114121058 missense probably benign 0.00
IGL03384:Usp30 APN 5 114121574 missense probably damaging 1.00
R0095:Usp30 UTSW 5 114105840 missense probably damaging 1.00
R0972:Usp30 UTSW 5 114111864 splice site probably benign
R1184:Usp30 UTSW 5 114103827 critical splice donor site probably null
R1589:Usp30 UTSW 5 114112961 missense probably damaging 1.00
R1678:Usp30 UTSW 5 114121146 missense probably damaging 1.00
R2127:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2129:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2341:Usp30 UTSW 5 114111180 nonsense probably null
R4677:Usp30 UTSW 5 114119644 missense probably damaging 1.00
R5191:Usp30 UTSW 5 114065694 start gained probably benign
R5956:Usp30 UTSW 5 114119621 missense possibly damaging 0.89
R6730:Usp30 UTSW 5 114103709 missense probably damaging 1.00
R6947:Usp30 UTSW 5 114103760 missense probably benign 0.01
R7653:Usp30 UTSW 5 114121669 missense probably damaging 1.00
R7654:Usp30 UTSW 5 114102445 missense probably damaging 1.00
R7794:Usp30 UTSW 5 114112972 nonsense probably null
R8063:Usp30 UTSW 5 114100463 missense probably benign 0.01
R8100:Usp30 UTSW 5 114111184 missense probably damaging 1.00
R8393:Usp30 UTSW 5 114121765 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCCCATTTCAGTGCTGTG -3'
(R):5'- CGTTAAACTGCACGTGCTCG -3'

Sequencing Primer
(F):5'- AGTGCTGTGTTTCCTTTGCC -3'
(R):5'- TGCTCGTGCCGCTTCAAG -3'
Posted On2019-10-24