Incidental Mutation 'R7572:Stk38l'
ID586080
Institutional Source Beutler Lab
Gene Symbol Stk38l
Ensembl Gene ENSMUSG00000001630
Gene Nameserine/threonine kinase 38 like
Synonyms4930473A22Rik, Ndr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146724995-146778812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146775654 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 443 (Y443C)
Ref Sequence ENSEMBL: ENSMUSP00000001675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001675] [ENSMUST00000111644]
Predicted Effect probably damaging
Transcript: ENSMUST00000001675
AA Change: Y443C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001675
Gene: ENSMUSG00000001630
AA Change: Y443C

DomainStartEndE-ValueType
S_TKc 90 383 5.62e-100 SMART
S_TK_X 384 445 2.88e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111644
AA Change: Y450C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107271
Gene: ENSMUSG00000001630
AA Change: Y450C

DomainStartEndE-ValueType
S_TKc 90 383 5.62e-100 SMART
S_TK_X 384 452 3.66e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
MGI Phenotype PHENOTYPE: Homozygous gene-trapped mice exhibit premature dendritic branching of CA3 pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Stk38l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Stk38l APN 6 146758473 start codon destroyed probably null 0.05
IGL00976:Stk38l APN 6 146775402 missense probably benign 0.37
IGL01607:Stk38l APN 6 146771654 missense probably damaging 0.99
IGL01607:Stk38l APN 6 146772227 splice site probably benign
IGL02552:Stk38l APN 6 146767533 missense probably damaging 1.00
IGL02582:Stk38l APN 6 146766823 critical splice donor site probably null
IGL03036:Stk38l APN 6 146768874 missense probably damaging 1.00
R0445:Stk38l UTSW 6 146775686 missense probably benign
R1518:Stk38l UTSW 6 146771631 missense probably benign 0.09
R2117:Stk38l UTSW 6 146768846 missense probably damaging 1.00
R5297:Stk38l UTSW 6 146775655 nonsense probably null
R5602:Stk38l UTSW 6 146758500 missense probably benign 0.39
R5652:Stk38l UTSW 6 146773328 missense possibly damaging 0.91
R6830:Stk38l UTSW 6 146766771 missense possibly damaging 0.88
R8028:Stk38l UTSW 6 146773383 missense probably damaging 1.00
R8120:Stk38l UTSW 6 146758601 missense probably benign
R8142:Stk38l UTSW 6 146758572 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTTTGATGACTTCCCTGAGTCTG -3'
(R):5'- AGCCTCAGATTCCCAAGCTG -3'

Sequencing Primer
(F):5'- CTGAGTCTGATATCTTACAGCCAGG -3'
(R):5'- AGATTCCCAAGCTGTAGTCG -3'
Posted On2019-10-24