Incidental Mutation 'R7572:Gm3604'
ID586099
Institutional Source Beutler Lab
Gene Symbol Gm3604
Ensembl Gene ENSMUSG00000094942
Gene Namepredicted gene 3604
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location62368328-62383177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62370246 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 79 (I79T)
Ref Sequence ENSEMBL: ENSMUSP00000144048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107989] [ENSMUST00000187656] [ENSMUST00000202194]
Predicted Effect silent
Transcript: ENSMUST00000107989
SMART Domains Protein: ENSMUSP00000103623
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 3 65 4.49e-17 SMART
ZnF_C2H2 132 154 2.71e-2 SMART
ZnF_C2H2 160 182 1.3e-4 SMART
ZnF_C2H2 188 210 5.21e-4 SMART
ZnF_C2H2 216 238 1.82e-3 SMART
ZnF_C2H2 244 266 7.78e-3 SMART
ZnF_C2H2 272 294 3.69e-4 SMART
ZnF_C2H2 300 322 3.95e-4 SMART
ZnF_C2H2 328 350 9.08e-4 SMART
ZnF_C2H2 356 378 1.45e-2 SMART
ZnF_C2H2 384 406 1.92e-2 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 1.4e-4 SMART
ZnF_C2H2 496 518 3.95e-4 SMART
ZnF_C2H2 524 546 2.29e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000187656
SMART Domains Protein: ENSMUSP00000139845
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 4 66 1.9e-19 SMART
ZnF_C2H2 133 155 1.2e-4 SMART
ZnF_C2H2 161 183 5.5e-7 SMART
ZnF_C2H2 189 211 2.3e-6 SMART
ZnF_C2H2 217 239 7.5e-6 SMART
ZnF_C2H2 245 267 3.4e-5 SMART
ZnF_C2H2 273 295 1.5e-6 SMART
ZnF_C2H2 301 323 1.7e-6 SMART
ZnF_C2H2 329 351 3.7e-6 SMART
ZnF_C2H2 357 379 6.3e-5 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 5.5e-7 SMART
ZnF_C2H2 441 463 2e-6 SMART
ZnF_C2H2 469 491 5.8e-7 SMART
ZnF_C2H2 497 519 1.6e-6 SMART
ZnF_C2H2 525 547 9.6e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202194
AA Change: I79T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144048
Gene: ENSMUSG00000094942
AA Change: I79T

DomainStartEndE-ValueType
KRAB 4 65 1.2e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Gm3604
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gm3604 APN 13 62370140 missense probably damaging 1.00
IGL02601:Gm3604 APN 13 62370176 missense possibly damaging 0.79
IGL03386:Gm3604 APN 13 62370167 missense possibly damaging 0.95
R1539:Gm3604 UTSW 13 62371600 missense possibly damaging 0.70
R1771:Gm3604 UTSW 13 62370074 nonsense probably null
R1776:Gm3604 UTSW 13 62370074 nonsense probably null
R1919:Gm3604 UTSW 13 62369942 missense probably benign 0.02
R1954:Gm3604 UTSW 13 62369211 missense probably damaging 0.97
R2093:Gm3604 UTSW 13 62369606 missense possibly damaging 0.50
R2291:Gm3604 UTSW 13 62371843 missense probably damaging 0.99
R2909:Gm3604 UTSW 13 62369018 missense probably benign 0.43
R3195:Gm3604 UTSW 13 62370054 nonsense probably null
R3196:Gm3604 UTSW 13 62370054 nonsense probably null
R3924:Gm3604 UTSW 13 62370230 missense probably damaging 0.99
R4328:Gm3604 UTSW 13 62369265 missense possibly damaging 0.88
R4543:Gm3604 UTSW 13 62370156 missense probably benign
R4830:Gm3604 UTSW 13 62369043 missense probably damaging 0.98
R5129:Gm3604 UTSW 13 62369774 missense probably benign 0.00
R5496:Gm3604 UTSW 13 62371579 missense possibly damaging 0.85
R6184:Gm3604 UTSW 13 62371845 missense probably damaging 1.00
R6426:Gm3604 UTSW 13 62369622 missense probably damaging 1.00
R6925:Gm3604 UTSW 13 62369390 missense probably benign 0.16
R7080:Gm3604 UTSW 13 62370295 missense probably damaging 1.00
R7182:Gm3604 UTSW 13 62371875 missense probably damaging 0.99
R7750:Gm3604 UTSW 13 62369996 missense possibly damaging 0.92
R8023:Gm3604 UTSW 13 62369869 missense probably damaging 1.00
R8062:Gm3604 UTSW 13 62370341 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTTGAAGAGTACTGTGTTGTGAAAA -3'
(R):5'- CACGGTGGCTCACAACCATC -3'

Sequencing Primer
(F):5'- GTAGGGTTTCTCTCCAGTATGAAATC -3'
(R):5'- TCGGGACAGCTACAGTGTACTTAC -3'
Posted On2019-10-24