Incidental Mutation 'R0620:Olfr311'
ID 58612
Institutional Source Beutler Lab
Gene Symbol Olfr311
Ensembl Gene ENSMUSG00000094805
Gene Name olfactory receptor 311
Synonyms MOR222-1, GA_x6K02T2NKPP-565870-564944
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58839251-58844111 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58841443 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 110 (C110G)
Ref Sequence ENSEMBL: ENSMUSP00000150870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071625] [ENSMUST00000216473]
AlphaFold Q5NC59
Predicted Effect probably damaging
Transcript: ENSMUST00000071625
AA Change: C110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071553
Gene: ENSMUSG00000094805
AA Change: C110G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 9e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 215 1.7e-8 PFAM
Pfam:7tm_1 39 288 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214776
Predicted Effect probably damaging
Transcript: ENSMUST00000216473
AA Change: C110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1881 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Olfr311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Olfr311 APN 11 58841512 missense probably benign 0.10
H8786:Olfr311 UTSW 11 58841320 missense probably benign 0.22
R0671:Olfr311 UTSW 11 58841855 missense possibly damaging 0.94
R0827:Olfr311 UTSW 11 58841771 missense probably damaging 1.00
R0839:Olfr311 UTSW 11 58841652 missense probably benign
R0932:Olfr311 UTSW 11 58841714 missense possibly damaging 0.92
R1117:Olfr311 UTSW 11 58841815 missense possibly damaging 0.64
R1533:Olfr311 UTSW 11 58841966 missense probably damaging 1.00
R1540:Olfr311 UTSW 11 58841651 missense probably benign 0.01
R1595:Olfr311 UTSW 11 58841652 missense probably benign
R1826:Olfr311 UTSW 11 58841431 missense probably benign
R2857:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2858:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2859:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R3438:Olfr311 UTSW 11 58841872 nonsense probably null
R3765:Olfr311 UTSW 11 58841294 missense probably damaging 1.00
R3831:Olfr311 UTSW 11 58841860 missense probably damaging 0.99
R4858:Olfr311 UTSW 11 58841207 missense possibly damaging 0.86
R5651:Olfr311 UTSW 11 58841491 nonsense probably null
R5979:Olfr311 UTSW 11 58841840 missense probably damaging 1.00
R6316:Olfr311 UTSW 11 58841942 missense probably damaging 1.00
R6717:Olfr311 UTSW 11 58841287 missense probably damaging 1.00
R7163:Olfr311 UTSW 11 58841186 missense probably benign 0.12
R7605:Olfr311 UTSW 11 58841500 missense probably benign 0.00
R8328:Olfr311 UTSW 11 58841634 missense probably benign 0.00
Z1186:Olfr311 UTSW 11 58841081 start gained probably benign
Z1186:Olfr311 UTSW 11 58841119 missense probably benign
Z1186:Olfr311 UTSW 11 58841206 missense probably benign
Z1186:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1186:Olfr311 UTSW 11 58841789 missense probably benign
Z1187:Olfr311 UTSW 11 58841081 start gained probably benign
Z1187:Olfr311 UTSW 11 58841119 missense probably benign
Z1187:Olfr311 UTSW 11 58841206 missense probably benign
Z1187:Olfr311 UTSW 11 58841258 missense probably benign
Z1187:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1187:Olfr311 UTSW 11 58841789 missense probably benign
Z1188:Olfr311 UTSW 11 58841081 start gained probably benign
Z1188:Olfr311 UTSW 11 58841119 missense probably benign
Z1188:Olfr311 UTSW 11 58841206 missense probably benign
Z1188:Olfr311 UTSW 11 58841258 missense probably benign
Z1188:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1188:Olfr311 UTSW 11 58841789 missense probably benign
Z1189:Olfr311 UTSW 11 58841081 start gained probably benign
Z1189:Olfr311 UTSW 11 58841119 missense probably benign
Z1189:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1189:Olfr311 UTSW 11 58841789 missense probably benign
Z1190:Olfr311 UTSW 11 58841081 start gained probably benign
Z1190:Olfr311 UTSW 11 58841119 missense probably benign
Z1190:Olfr311 UTSW 11 58841206 missense probably benign
Z1190:Olfr311 UTSW 11 58841258 missense probably benign
Z1190:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1190:Olfr311 UTSW 11 58841789 missense probably benign
Z1191:Olfr311 UTSW 11 58841081 start gained probably benign
Z1191:Olfr311 UTSW 11 58841119 missense probably benign
Z1191:Olfr311 UTSW 11 58841206 missense probably benign
Z1191:Olfr311 UTSW 11 58841258 missense probably benign
Z1191:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1191:Olfr311 UTSW 11 58841789 missense probably benign
Z1192:Olfr311 UTSW 11 58841081 start gained probably benign
Z1192:Olfr311 UTSW 11 58841119 missense probably benign
Z1192:Olfr311 UTSW 11 58841206 missense probably benign
Z1192:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1192:Olfr311 UTSW 11 58841789 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACACAATCTGAGCAGACATGGC -3'
(R):5'- TGCAGGACAGTCTCATGACTGGTG -3'

Sequencing Primer
(F):5'- GGGAACTTCTCCATCATCACGG -3'
(R):5'- CATGTCACAGAAGAAGTGATCAAC -3'
Posted On 2013-07-11