Incidental Mutation 'R7573:Kcnq2'
ID586134
Institutional Source Beutler Lab
Gene Symbol Kcnq2
Ensembl Gene ENSMUSG00000016346
Gene Namepotassium voltage-gated channel, subfamily Q, member 2
SynonymsKQT2, Nmf134
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181075579-181135300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181081589 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 693 (S693P)
Ref Sequence ENSEMBL: ENSMUSP00000122915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016491] [ENSMUST00000049792] [ENSMUST00000081528] [ENSMUST00000103047] [ENSMUST00000103048] [ENSMUST00000103050] [ENSMUST00000103051] [ENSMUST00000129695] [ENSMUST00000149964] [ENSMUST00000197015]
Predicted Effect probably damaging
Transcript: ENSMUST00000016491
AA Change: S701P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016491
Gene: ENSMUSG00000016346
AA Change: S701P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.3e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 595 2e-59 PFAM
Pfam:KCNQ_channel 593 673 1.7e-22 PFAM
low complexity region 711 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000049792
AA Change: S696P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052453
Gene: ENSMUSG00000016346
AA Change: S696P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.2e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 565 3.1e-55 PFAM
Pfam:KCNQ_channel 587 668 6.8e-23 PFAM
low complexity region 706 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081528
SMART Domains Protein: ENSMUSP00000080243
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 4.3e-29 PFAM
Pfam:Ion_trans_2 237 317 1.7e-14 PFAM
Pfam:KCNQ_channel 436 564 2.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103047
AA Change: S689P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099336
Gene: ENSMUSG00000016346
AA Change: S689P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.1e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 424 583 2e-59 PFAM
Pfam:KCNQ_channel 581 661 1.7e-22 PFAM
low complexity region 699 711 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103048
AA Change: S665P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099337
Gene: ENSMUSG00000016346
AA Change: S665P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 6.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.4e-14 PFAM
Pfam:KCNQ_channel 436 637 1.3e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000099338
Gene: ENSMUSG00000016346
AA Change: S617P

DomainStartEndE-ValueType
Pfam:Ion_trans 35 268 3.7e-32 PFAM
Pfam:Ion_trans_2 181 261 1.1e-14 PFAM
Pfam:KCNQ_channel 392 584 1e-92 PFAM
Pfam:KCNQ2_u3 591 679 3.9e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 692 791 1.1e-48 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000099339
Gene: ENSMUSG00000016346
AA Change: S662P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103051
AA Change: S675P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099340
Gene: ENSMUSG00000016346
AA Change: S675P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.9e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 446 647 1.7e-82 PFAM
low complexity region 685 697 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 747 849 1.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129695
AA Change: S549P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123488
Gene: ENSMUSG00000016346
AA Change: S549P

DomainStartEndE-ValueType
Pfam:Ion_trans 14 198 6.8e-29 PFAM
Pfam:Ion_trans_2 123 203 2.4e-14 PFAM
Pfam:KCNQ_channel 320 521 1.3e-82 PFAM
low complexity region 559 571 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 621 723 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149964
AA Change: S693P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122915
Gene: ENSMUSG00000016346
AA Change: S693P

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 4.4e-32 PFAM
Pfam:Ion_trans_2 237 317 1.3e-14 PFAM
low complexity region 418 431 N/A INTRINSIC
Pfam:KCNQ_channel 466 659 6.2e-94 PFAM
Pfam:KCNQ2_u3 666 754 4.5e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 767 866 1.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197015
AA Change: S665P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143263
Gene: ENSMUSG00000016346
AA Change: S665P

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197599
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die perinatally with pulmonary atelectasis. Heterozygous mice exhibit a hypersensitivity to the epileptic inducer pentylenetetrazole. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Kcnq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Kcnq2 APN 2 181109789 unclassified probably benign
IGL02064:Kcnq2 APN 2 181109026 missense probably damaging 1.00
IGL02231:Kcnq2 APN 2 181081715 missense probably benign 0.22
IGL02261:Kcnq2 APN 2 181081690 missense probably damaging 0.98
IGL02510:Kcnq2 APN 2 181081361 missense probably benign
IGL02583:Kcnq2 APN 2 181081502 missense probably benign 0.01
IGL02627:Kcnq2 APN 2 181082327 unclassified probably benign
IGL03303:Kcnq2 APN 2 181082389 missense probably benign
R0269:Kcnq2 UTSW 2 181096974 missense probably benign 0.00
R1535:Kcnq2 UTSW 2 181134825 missense probably damaging 1.00
R1688:Kcnq2 UTSW 2 181087033 missense probably damaging 1.00
R1776:Kcnq2 UTSW 2 181100557 missense probably benign 0.01
R1946:Kcnq2 UTSW 2 181088451 missense probably benign 0.09
R2105:Kcnq2 UTSW 2 181081352 missense probably benign 0.03
R2382:Kcnq2 UTSW 2 181112107 missense probably damaging 1.00
R2912:Kcnq2 UTSW 2 181081774 missense probably damaging 1.00
R3826:Kcnq2 UTSW 2 181104900 missense possibly damaging 0.56
R3898:Kcnq2 UTSW 2 181109686 missense probably damaging 0.97
R4282:Kcnq2 UTSW 2 181081153 missense probably damaging 1.00
R4938:Kcnq2 UTSW 2 181086973 missense probably damaging 0.96
R4962:Kcnq2 UTSW 2 181112043 missense possibly damaging 0.59
R5055:Kcnq2 UTSW 2 181086761 intron probably benign
R5107:Kcnq2 UTSW 2 181108547 intron probably benign
R5371:Kcnq2 UTSW 2 181135020 missense probably damaging 1.00
R5557:Kcnq2 UTSW 2 181134897 missense probably benign 0.07
R5839:Kcnq2 UTSW 2 181109751 missense probably damaging 1.00
R5998:Kcnq2 UTSW 2 181087008 missense probably damaging 1.00
R6084:Kcnq2 UTSW 2 181087656 missense possibly damaging 0.53
R6207:Kcnq2 UTSW 2 181113233 missense possibly damaging 0.49
R6744:Kcnq2 UTSW 2 181085306 missense possibly damaging 0.94
R7018:Kcnq2 UTSW 2 181081724 nonsense probably null
R7266:Kcnq2 UTSW 2 181135092 start codon destroyed probably null 0.92
R7291:Kcnq2 UTSW 2 181088379 missense possibly damaging 0.69
R7319:Kcnq2 UTSW 2 181109102 missense probably damaging 1.00
R7447:Kcnq2 UTSW 2 181113094 missense probably damaging 0.97
R7897:Kcnq2 UTSW 2 181081141 missense probably damaging 1.00
R7980:Kcnq2 UTSW 2 181081141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAGAACTCGGTACTGGC -3'
(R):5'- TGTCCATGGAAAAGAAGCTCG -3'

Sequencing Primer
(F):5'- AAGAACTCGGTACTGGCTCTGTTG -3'
(R):5'- GACTTCTTGGTGAGCATCTATACAC -3'
Posted On2019-10-24