Incidental Mutation 'R7573:Ccdc180'
ID586138
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45922015 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1030 (T1030A)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect probably benign
Transcript: ENSMUST00000149903
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151024
SMART Domains Protein: ENSMUSP00000122332
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
coiled coil region 90 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178561
AA Change: T1030A

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: T1030A

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGAGTTGGGCAGTGTATC -3'
(R):5'- TGGGACCAGCCACTAAATATTCC -3'

Sequencing Primer
(F):5'- AGGATTCCCACCAGGCTCAG -3'
(R):5'- GCCACTAAATATTCCTGATGTCACAG -3'
Posted On2019-10-24