Incidental Mutation 'R0620:Gm11563'
ID 58614
Institutional Source Beutler Lab
Gene Symbol Gm11563
Ensembl Gene ENSMUSG00000069718
Gene Name predicted gene 11563
Synonyms
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 99657949-99658960 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99658437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 164 (A164T)
Ref Sequence ENSEMBL: ENSMUSP00000090369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092695]
AlphaFold B1AQ90
Predicted Effect unknown
Transcript: ENSMUST00000092695
AA Change: A164T
SMART Domains Protein: ENSMUSP00000090369
Gene: ENSMUSG00000069718
AA Change: A164T

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 58 3.9e-10 PFAM
Pfam:Keratin_B2_2 44 88 7.8e-16 PFAM
Pfam:Keratin_B2_2 59 102 3.7e-14 PFAM
internal_repeat_1 142 157 9.92e-7 PROSPERO
internal_repeat_1 152 167 9.92e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119334
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Gm11563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Gm11563 APN 11 99658701 nonsense probably null
IGL02125:Gm11563 APN 11 99658805 missense unknown
R0551:Gm11563 UTSW 11 99658713 missense unknown
R0584:Gm11563 UTSW 11 99658625 missense unknown
R1246:Gm11563 UTSW 11 99658848 missense unknown
R4575:Gm11563 UTSW 11 99658449 missense unknown
R4745:Gm11563 UTSW 11 99658420 makesense probably null
R5279:Gm11563 UTSW 11 99658713 missense unknown
R6945:Gm11563 UTSW 11 99658472 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCTCTGAAGGTTTGACCTGACTC -3'
(R):5'- AGCTGCTGTCAACCCTCCTGTG -3'

Sequencing Primer
(F):5'- tcacattaacatttccattcctcc -3'
(R):5'- accctcctgtggtagctc -3'
Posted On 2013-07-11