Incidental Mutation 'R7573:Pnkp'
ID586158
Institutional Source Beutler Lab
Gene Symbol Pnkp
Ensembl Gene ENSMUSG00000002963
Gene Namepolynucleotide kinase 3'- phosphatase
SynonymsPNK, 1810009G08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44857139-44862992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44857428 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 9 (R9C)
Ref Sequence ENSEMBL: ENSMUSP00000003044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000054343] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000107880] [ENSMUST00000107882] [ENSMUST00000107885] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000127783] [ENSMUST00000136232] [ENSMUST00000139003] [ENSMUST00000141311] [ENSMUST00000150335] [ENSMUST00000154968] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207223] [ENSMUST00000208384]
Predicted Effect probably damaging
Transcript: ENSMUST00000003044
AA Change: R9C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054343
SMART Domains Protein: ENSMUSP00000049764
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098478
AA Change: R9C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107876
AA Change: R9C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107880
SMART Domains Protein: ENSMUSP00000103512
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107882
SMART Domains Protein: ENSMUSP00000103514
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 59 86 N/A INTRINSIC
low complexity region 92 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107885
SMART Domains Protein: ENSMUSP00000103517
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 104 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
Pfam:PRAS 199 323 1.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123015
AA Change: R9C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000124168
AA Change: R9C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000127783
SMART Domains Protein: ENSMUSP00000116149
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
Pfam:PRAS 134 247 1.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136232
SMART Domains Protein: ENSMUSP00000116541
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 95 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139003
AA Change: R9C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143904
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141311
SMART Domains Protein: ENSMUSP00000120690
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 40 67 N/A INTRINSIC
low complexity region 73 108 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142880
Predicted Effect probably benign
Transcript: ENSMUST00000150335
SMART Domains Protein: ENSMUSP00000122607
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154968
AA Change: R9C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000155050
AA Change: R9C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200892
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201882
AA Change: R9C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963
AA Change: R9C

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202646
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207223
Predicted Effect probably benign
Transcript: ENSMUST00000208384
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a frame-shift allele are embryonic lethal. Homozygotes for a hypomorphic allele exhibit smaller brain (cortex and cerebellum) and defects in both single- and double-strand DNA break repair associated with increased brain apoptosis and decreased proliferation in cortical progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Pnkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Pnkp APN 7 44862207 missense probably damaging 1.00
IGL02750:Pnkp APN 7 44860187 unclassified probably benign
IGL02822:Pnkp APN 7 44862424 missense probably damaging 1.00
R1168:Pnkp UTSW 7 44862537 missense probably benign 0.00
R1437:Pnkp UTSW 7 44860402 missense possibly damaging 0.87
R1953:Pnkp UTSW 7 44862602 missense probably benign 0.02
R2879:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R4329:Pnkp UTSW 7 44858594 missense probably benign 0.02
R4732:Pnkp UTSW 7 44860454 unclassified probably benign
R4842:Pnkp UTSW 7 44861646 splice site probably null
R4846:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4872:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4873:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4875:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5068:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5120:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5121:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5266:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5267:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R6532:Pnkp UTSW 7 44857405 start codon destroyed probably null 0.99
R6974:Pnkp UTSW 7 44861038 missense probably damaging 1.00
R7289:Pnkp UTSW 7 44858690 missense probably damaging 1.00
R7326:Pnkp UTSW 7 44859734 missense probably damaging 1.00
R7394:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R7995:Pnkp UTSW 7 44858536 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCTCACTGCGCATTGGAAC -3'
(R):5'- TTGCTTCTGGCTAGGCATAG -3'

Sequencing Primer
(F):5'- ACTGCGCATTGGAACCGTTG -3'
(R):5'- TAGGCATAGGCTCCCCTG -3'
Posted On2019-10-24