Incidental Mutation 'R7573:C2cd3'
ID586159
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100419707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 536 (D536G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: D914G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: D914G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: D914G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: D914G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: D536G

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133464
SMART Domains Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7869:C2cd3 UTSW 7 100469491 missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100459889 critical splice donor site probably null
R8134:C2cd3 UTSW 7 100418504 missense
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTGTAGATTGAATTTACCTGCCTTG -3'
(R):5'- AACAGATGCTACAGGTGGCTG -3'

Sequencing Primer
(F):5'- ACCTGCCTTGTAATTTTAGTTTGG -3'
(R):5'- ATCTGAGCTGAAGAACCC -3'
Posted On2019-10-24