Incidental Mutation 'R7573:Olfr1537'
ID586168
Institutional Source Beutler Lab
Gene Symbol Olfr1537
Ensembl Gene ENSMUSG00000096109
Gene Nameolfactory receptor 1537
SynonymsMOR171-41P, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, Olfr1537-ps1, K4, MOR171-32P, Olfr144
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39234412-39249994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39237681 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 248 (V248I)
Ref Sequence ENSEMBL: ENSMUSP00000149992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073248] [ENSMUST00000213472]
Predicted Effect probably benign
Transcript: ENSMUST00000073248
AA Change: V251I

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072979
Gene: ENSMUSG00000096109
AA Change: V251I

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.4e-51 PFAM
Pfam:7tm_1 44 293 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213472
AA Change: V248I

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Olfr1537
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr1537 APN 9 39237605 missense probably benign 0.25
IGL01691:Olfr1537 APN 9 39238019 missense probably benign 0.00
IGL02606:Olfr1537 APN 9 39238194 missense probably damaging 0.98
IGL02656:Olfr1537 APN 9 39238160 missense probably benign 0.13
R0133:Olfr1537 UTSW 9 39238011 missense probably benign 0.00
R0548:Olfr1537 UTSW 9 39238371 missense probably benign 0.13
R0558:Olfr1537 UTSW 9 39238200 missense probably damaging 0.96
R0616:Olfr1537 UTSW 9 39237650 missense probably benign 0.00
R0626:Olfr1537 UTSW 9 39237866 missense possibly damaging 0.52
R0826:Olfr1537 UTSW 9 39238429 start codon destroyed probably null 0.00
R0839:Olfr1537 UTSW 9 39237850 missense possibly damaging 0.51
R1074:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1224:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1226:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1252:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1256:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1355:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1356:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1416:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1499:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1658:Olfr1537 UTSW 9 39237959 missense probably benign 0.03
R1815:Olfr1537 UTSW 9 39237990 missense probably benign 0.01
R2198:Olfr1537 UTSW 9 39237752 missense possibly damaging 0.48
R4178:Olfr1537 UTSW 9 39238079 nonsense probably null
R5112:Olfr1537 UTSW 9 39238421 start codon destroyed probably null 0.94
R6251:Olfr1537 UTSW 9 39238218 missense possibly damaging 0.94
R6850:Olfr1537 UTSW 9 39237975 missense probably benign 0.01
R7032:Olfr1537 UTSW 9 39237687 missense possibly damaging 0.73
R7715:Olfr1537 UTSW 9 39237878 missense probably damaging 1.00
R7722:Olfr1537 UTSW 9 39237589 nonsense probably null
R7729:Olfr1537 UTSW 9 39238250 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AATCCTCACATGATTTCTGCTTACATG -3'
(R):5'- ATGCTTAGGACTCAGTTCTGC -3'

Sequencing Primer
(F):5'- TCAGCATGGGTACAACAG -3'
(R):5'- GCTTAGGACTCAGTTCTGCAATTTAG -3'
Posted On2019-10-24