Incidental Mutation 'R7573:Cdh23'
ID586172
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Namecadherin 23 (otocadherin)
Synonymsnmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.673) question?
Stock #R7573 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location60302748-60696490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60323550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2151 (T2151A)
Ref Sequence ENSEMBL: ENSMUSP00000101101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
Predicted Effect probably benign
Transcript: ENSMUST00000073242
AA Change: T2150A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: T2150A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
AA Change: T2151A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: T2151A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
AA Change: T2153A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: T2153A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
AA Change: T2151A

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: T2151A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105464
AA Change: T2149A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: T2149A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
hersey UTSW 10 60308036 missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7009:Cdh23 UTSW 10 60337306 missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60384945 missense probably benign 0.17
R7578:Cdh23 UTSW 10 60407407 missense probably benign 0.14
R7646:Cdh23 UTSW 10 60305152 missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60337264 missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60312577 missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60385194 missense probably benign 0.07
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTGGCCACGATGCTGATGATG -3'
(R):5'- CAGGATTCTCAGTCCTTCAAGTC -3'

Sequencing Primer
(F):5'- CACGATGCTGATGATGTGATACTCC -3'
(R):5'- TTCAAGTCACAGCCACGGATGAG -3'
Posted On2019-10-24