Incidental Mutation 'R7573:Tbx2'
ID586176
Institutional Source Beutler Lab
Gene Symbol Tbx2
Ensembl Gene ENSMUSG00000000093
Gene NameT-box 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7573 (G1)
Quality Score221.009
Status Not validated
Chromosome11
Chromosomal Location85832551-85841948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 85833312 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 69 (A69G)
Ref Sequence ENSEMBL: ENSMUSP00000000095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000095
AA Change: A69G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000095
Gene: ENSMUSG00000000093
AA Change: A69G

DomainStartEndE-ValueType
low complexity region 28 75 N/A INTRINSIC
TBOX 104 292 2.44e-130 SMART
Pfam:TBX 305 382 1.5e-18 PFAM
low complexity region 391 408 N/A INTRINSIC
low complexity region 509 549 N/A INTRINSIC
SCOP:d1gkub1 582 612 5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product is the human homolog of mouse Tbx2, and shares strong sequence similarity with Drosophila omb protein. Expression studies indicate that this gene may have a potential role in tumorigenesis as an immortalizing agent. Transcript heterogeneity due to alternative polyadenylation has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal cardiac and vascular development, edema, and polydactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Tbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02499:Tbx2 APN 11 85840913 missense possibly damaging 0.82
PIT4480001:Tbx2 UTSW 11 85834735 missense probably damaging 1.00
R1295:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1296:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1384:Tbx2 UTSW 11 85833492 missense probably benign 0.01
R1501:Tbx2 UTSW 11 85834796 missense probably damaging 1.00
R3949:Tbx2 UTSW 11 85838275 nonsense probably null
R4451:Tbx2 UTSW 11 85840817 missense probably damaging 1.00
R5214:Tbx2 UTSW 11 85838437 missense probably benign 0.02
R5690:Tbx2 UTSW 11 85837053 missense probably damaging 1.00
R6186:Tbx2 UTSW 11 85837846 nonsense probably null
R7211:Tbx2 UTSW 11 85834714 missense probably damaging 1.00
R7353:Tbx2 UTSW 11 85833489 missense probably damaging 0.96
R7529:Tbx2 UTSW 11 85840901 missense probably benign 0.02
R7626:Tbx2 UTSW 11 85840796 missense probably benign 0.00
R7762:Tbx2 UTSW 11 85835901 missense probably damaging 1.00
R7996:Tbx2 UTSW 11 85834790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCTAACCAGTCGCGCG -3'
(R):5'- AATCCGAGAGAGCATCGACC -3'

Sequencing Primer
(F):5'- ATGTCCCGATGAGAGAGCC -3'
(R):5'- TACCTCCCGGACTTGGTGATG -3'
Posted On2019-10-24