Incidental Mutation 'R7573:Crygs'
ID586186
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Namecrystallin, gamma S
SynonymsOpj
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location22805203-22811577 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 22805319 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 179 (*179C)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
PDB Structure
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000040592
AA Change: *179C
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: *179C

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22806562 missense possibly damaging 0.81
R1694:Crygs UTSW 16 22806675 splice site probably null
R1932:Crygs UTSW 16 22806554 missense probably benign 0.12
R2206:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2275:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2298:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2299:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2300:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2326:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2329:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2330:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2331:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2332:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2857:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2895:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2896:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2921:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2922:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3120:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3196:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3427:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3609:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3611:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3625:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3693:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3694:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3695:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3870:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3871:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3876:Crygs UTSW 16 22806512 missense probably damaging 1.00
R4052:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4299:Crygs UTSW 16 22805411 nonsense probably null
R4630:Crygs UTSW 16 22805518 missense possibly damaging 0.90
R7392:Crygs UTSW 16 22806502 missense probably benign 0.35
R8172:Crygs UTSW 16 22806542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGTAAATGCCCACTGTG -3'
(R):5'- CCACGGAAGACTGTCCTTCTATC -3'

Sequencing Primer
(F):5'- TGTAAATGCCCACTGTGGAGGG -3'
(R):5'- GAAGACTGTCCTTCTATCATGGAGC -3'
Posted On2019-10-24