Incidental Mutation 'R0620:Dio2'
ID 58619
Institutional Source Beutler Lab
Gene Symbol Dio2
Ensembl Gene ENSMUSG00000007682
Gene Name deiodinase, iodothyronine, type II
Synonyms
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0620 (G1)
Quality Score 118
Status Validated
Chromosome 12
Chromosomal Location 90724552-90738438 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90738071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 72 (Y72H)
Ref Sequence ENSEMBL: ENSMUSP00000081013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082432]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082432
AA Change: Y72H

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081013
Gene: ENSMUSG00000007682
AA Change: Y72H

DomainStartEndE-ValueType
Pfam:T4_deiodinase 4 259 1.6e-119 PFAM
Pfam:AhpC-TSA 78 237 1.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221942
Meta Mutation Damage Score 0.2029 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is highly expressed in brain, placenta and mammary gland. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. Knockout studies in mice suggest that this gene may play an important role in brown adipose tissue lipogenesis, auditory function, and bone formation. This protein is a selenoprotein containing the rare selenocysteine (Sec) amino acid at its active site, and may contain additional Sec residues. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display elevated thyroxine (T4) and thyroid-stimulating hormone levels, changes in the metabolism and excretion of iodothyronines, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Dio2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02665:Dio2 APN 12 90729653 missense possibly damaging 0.87
IGL02832:Dio2 APN 12 90729404 utr 3 prime probably benign
R0139:Dio2 UTSW 12 90729843 missense probably damaging 1.00
R0908:Dio2 UTSW 12 90729648 missense probably damaging 1.00
R1106:Dio2 UTSW 12 90738211 missense probably damaging 1.00
R1799:Dio2 UTSW 12 90729906 missense probably benign 0.00
R2099:Dio2 UTSW 12 90729823 makesense probably null
R2101:Dio2 UTSW 12 90729823 makesense probably null
R4615:Dio2 UTSW 12 90729821 missense probably damaging 1.00
R6560:Dio2 UTSW 12 90729833 nonsense probably null
R6960:Dio2 UTSW 12 90729897 missense probably damaging 0.97
R7587:Dio2 UTSW 12 90729560 missense probably benign 0.00
R9367:Dio2 UTSW 12 90729813 missense probably benign 0.07
Z1177:Dio2 UTSW 12 90729912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTACTGAAGTCACCAAGAGTCCC -3'
(R):5'- CTCAGCGTAGACTTGCTGATCACC -3'

Sequencing Primer
(F):5'- GTGTCTGTCACTCCCAAATCTAAC -3'
(R):5'- TCGGTCATTCTGCTCAAGCA -3'
Posted On 2013-07-11