Incidental Mutation 'R7573:Klhl14'
ID586190
Institutional Source Beutler Lab
Gene Symbol Klhl14
Ensembl Gene ENSMUSG00000042514
Gene Namekelch-like 14
Synonymsprintor, 6330403N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location21550377-21654718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21652154 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000042015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]
Predicted Effect probably benign
Transcript: ENSMUST00000049105
AA Change: V72A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: V72A

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122333
AA Change: V72A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: V72A

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Klhl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Klhl14 APN 18 21651864 missense probably benign 0.00
IGL01474:Klhl14 APN 18 21557854 missense probably damaging 0.99
IGL02005:Klhl14 APN 18 21624611 nonsense probably null
IGL02108:Klhl14 APN 18 21557920 missense probably damaging 0.98
IGL02371:Klhl14 APN 18 21652181 missense probably damaging 1.00
IGL03354:Klhl14 APN 18 21651728 missense probably damaging 1.00
P0027:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
PIT4810001:Klhl14 UTSW 18 21557823 nonsense probably null
R0288:Klhl14 UTSW 18 21565563 missense probably damaging 1.00
R1419:Klhl14 UTSW 18 21652193 missense probably damaging 0.99
R1606:Klhl14 UTSW 18 21565532 missense possibly damaging 0.94
R1771:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R1928:Klhl14 UTSW 18 21651786 missense probably damaging 1.00
R1966:Klhl14 UTSW 18 21554673 missense probably damaging 1.00
R3624:Klhl14 UTSW 18 21557896 missense probably damaging 1.00
R4541:Klhl14 UTSW 18 21554639 nonsense probably null
R4664:Klhl14 UTSW 18 21554708 missense probably benign 0.06
R4856:Klhl14 UTSW 18 21557972 intron probably null
R4886:Klhl14 UTSW 18 21557972 intron probably null
R4893:Klhl14 UTSW 18 21557935 missense probably damaging 1.00
R5393:Klhl14 UTSW 18 21651994 missense probably benign 0.30
R5757:Klhl14 UTSW 18 21554734 missense probably damaging 1.00
R5951:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R5958:Klhl14 UTSW 18 21565535 missense probably damaging 0.99
R7231:Klhl14 UTSW 18 21652136 missense probably damaging 0.99
R7519:Klhl14 UTSW 18 21651843 missense probably benign 0.36
R7527:Klhl14 UTSW 18 21651540 missense probably damaging 0.99
R7664:Klhl14 UTSW 18 21554649 missense probably damaging 1.00
R7737:Klhl14 UTSW 18 21558134 nonsense probably null
T0722:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
X0026:Klhl14 UTSW 18 21651941 missense possibly damaging 0.94
Z1177:Klhl14 UTSW 18 21652104 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCACTAGGTTGTTGATGGCTC -3'
(R):5'- TTGGAGGAGGGTTTAAAGCC -3'

Sequencing Primer
(F):5'- GCTCTGGGGCTGGTCAG -3'
(R):5'- AGCTCGCCATGTCCAGATC -3'
Posted On2019-10-24