Incidental Mutation 'R7573:Sema4g'
ID586195
Institutional Source Beutler Lab
Gene Symbol Sema4g
Ensembl Gene ENSMUSG00000025207
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44989101-45003397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44997571 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 284 (S284P)
Ref Sequence ENSEMBL: ENSMUSP00000026225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000130549] [ENSMUST00000179305]
Predicted Effect probably damaging
Transcript: ENSMUST00000026225
AA Change: S284P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207
AA Change: S284P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130549
AA Change: S284P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207
AA Change: S284P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179305
AA Change: S284P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207
AA Change: S284P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Meta Mutation Damage Score 0.7592 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit normal cerebellar morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Sema4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Sema4g APN 19 44997996 missense probably damaging 1.00
IGL01419:Sema4g APN 19 44997396 missense probably benign 0.00
IGL02033:Sema4g APN 19 44997415 missense probably damaging 1.00
IGL02092:Sema4g APN 19 44992639 critical splice donor site probably null
IGL02148:Sema4g APN 19 44996469 missense probably damaging 1.00
IGL02829:Sema4g APN 19 44992749 missense possibly damaging 0.95
IGL02837:Sema4g UTSW 19 44996711 missense probably damaging 0.96
R0550:Sema4g UTSW 19 44997665 missense probably benign
R0675:Sema4g UTSW 19 44997587 missense probably damaging 1.00
R1202:Sema4g UTSW 19 44998257 missense probably benign 0.31
R1346:Sema4g UTSW 19 44997652 missense possibly damaging 0.65
R1533:Sema4g UTSW 19 44992817 missense probably damaging 1.00
R1763:Sema4g UTSW 19 45001605 nonsense probably null
R1775:Sema4g UTSW 19 44999242 critical splice donor site probably null
R1803:Sema4g UTSW 19 44998020 missense probably benign 0.05
R1832:Sema4g UTSW 19 44999017 missense probably benign
R1909:Sema4g UTSW 19 44997622 missense probably damaging 0.96
R4035:Sema4g UTSW 19 45001414 missense probably damaging 0.99
R4131:Sema4g UTSW 19 44998919 missense probably benign
R4611:Sema4g UTSW 19 45001612 missense probably damaging 1.00
R4951:Sema4g UTSW 19 44996571 splice site probably null
R5921:Sema4g UTSW 19 44998704 missense probably benign 0.04
R8099:Sema4g UTSW 19 44992528 missense probably damaging 1.00
R8169:Sema4g UTSW 19 44998971 missense probably damaging 1.00
X0011:Sema4g UTSW 19 44998869 splice site probably null
Z1177:Sema4g UTSW 19 44998047 missense probably benign 0.03
Z1177:Sema4g UTSW 19 45001881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCACACAGAGTCGCAG -3'
(R):5'- GCCTGACCTCATTTTGCAGC -3'

Sequencing Primer
(F):5'- AGAGTCGCAGCAGCCAC -3'
(R):5'- AGCTCATCAGTGACGTCAGTTC -3'
Posted On2019-10-24