Incidental Mutation 'R7573:Sorcs1'
ID 586197
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R7573 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 50143299-50678646 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 50152796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1166 (Q1166*)
Ref Sequence ENSEMBL: ENSMUSP00000147456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072685
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
AA Change: Q1166*
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: Q1166*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
Predicted Effect probably benign
Transcript: ENSMUST00000209783
Predicted Effect probably null
Transcript: ENSMUST00000211008
AA Change: Q1166*
Predicted Effect probably benign
Transcript: ENSMUST00000211687
Meta Mutation Damage Score 0.9709 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Cfap157 T C 2: 32,777,508 H521R probably benign Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
R8463:Sorcs1 UTSW 19 50259810 missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50378960 missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50151220 missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50252658 missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50225220 missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50232315 missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50262295 missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50152862 missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50225213 missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50210770 missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50678083 missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50678083 missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50226837 missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGGGCATCGTAGCTTT -3'
(R):5'- GGCTCGCTGTATTCGTCATC -3'

Sequencing Primer
(F):5'- AAAAGGGGCATCGTAGCTTTTTCTC -3'
(R):5'- TTCTGCCAGGTTCAGAAGC -3'
Posted On 2019-10-24