Incidental Mutation 'R7574:Ccdc148'
ID 586207
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 045660-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7574 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58713645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 502 (Y502C)
Ref Sequence ENSEMBL: ENSMUSP00000076871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably damaging
Transcript: ENSMUST00000077687
AA Change: Y502C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: Y502C

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226455
AA Change: Y574C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,606,478 (GRCm39) V240A probably damaging Het
A930009A15Rik C T 10: 115,406,019 (GRCm39) probably benign Het
Aarsd1 A G 11: 101,301,970 (GRCm39) I201T probably damaging Het
Acaca T A 11: 84,152,414 (GRCm39) Y854N probably benign Het
Adra2c T C 5: 35,437,759 (GRCm39) L177P probably damaging Het
Akr1c12 A T 13: 4,329,309 (GRCm39) I16N probably damaging Het
Aldh8a1 A T 10: 21,256,729 (GRCm39) I47F possibly damaging Het
Birc6 A G 17: 74,886,879 (GRCm39) I736V probably benign Het
Bmp2 A T 2: 133,402,817 (GRCm39) M123L probably benign Het
C1ql1 T C 11: 102,836,812 (GRCm39) Y159C probably damaging Het
Ccdc168 A T 1: 44,098,593 (GRCm39) V835E possibly damaging Het
Cenpf A T 1: 189,390,864 (GRCm39) N989K probably damaging Het
Ciz1 A G 2: 32,257,380 (GRCm39) M142V probably benign Het
Cnot4 T C 6: 35,029,939 (GRCm39) R320G possibly damaging Het
Cyth1 G T 11: 118,073,689 (GRCm39) H215N probably damaging Het
Dapk1 G A 13: 60,908,987 (GRCm39) G1200D probably damaging Het
Dhps A G 8: 85,799,181 (GRCm39) Y103C probably damaging Het
Dnah1 T A 14: 31,041,865 (GRCm39) E35D probably benign Het
Dnajb9 A T 12: 44,254,169 (GRCm39) D79E probably damaging Het
Eif4a2 T C 16: 22,928,877 (GRCm39) F164S probably benign Het
Enpp2 T C 15: 54,714,813 (GRCm39) T595A probably benign Het
Exoc6b T A 6: 84,768,366 (GRCm39) probably null Het
Fam171a1 T C 2: 3,221,391 (GRCm39) S286P probably damaging Het
Fermt2 T A 14: 45,706,782 (GRCm39) N338I probably damaging Het
Fhdc1 A G 3: 84,353,438 (GRCm39) F596L probably benign Het
Fry T C 5: 150,304,359 (GRCm39) V583A probably benign Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gdap1 T A 1: 17,231,665 (GRCm39) F337I possibly damaging Het
Git2 C T 5: 114,904,550 (GRCm39) R123H probably damaging Het
Gpr6 A T 10: 40,946,652 (GRCm39) I310N possibly damaging Het
Gpsm2 G A 3: 108,608,061 (GRCm39) A239V probably damaging Het
Hexa T C 9: 59,471,267 (GRCm39) V507A probably benign Het
Hmcn2 A T 2: 31,345,531 (GRCm39) H4718L possibly damaging Het
Hrh4 T C 18: 13,154,970 (GRCm39) F170L possibly damaging Het
Ica1 T C 6: 8,658,266 (GRCm39) T284A probably benign Het
Itga5 T C 15: 103,258,876 (GRCm39) N774S probably damaging Het
Itgb2 T C 10: 77,395,992 (GRCm39) S556P probably benign Het
Kash5 A T 7: 44,854,035 (GRCm39) H31Q possibly damaging Het
Kcnq4 A G 4: 120,568,565 (GRCm39) F384L probably benign Het
Lama2 A T 10: 26,882,726 (GRCm39) N2612K probably benign Het
Lnx1 T C 5: 74,846,099 (GRCm39) E117G probably benign Het
Lrrc14b G T 13: 74,508,892 (GRCm39) A505E probably damaging Het
Ly6g T C 15: 75,030,413 (GRCm39) I77T probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrgpre C T 7: 143,335,087 (GRCm39) V139M probably damaging Het
Muc4 T A 16: 32,753,411 (GRCm38) S1096T probably benign Het
Myrfl G A 10: 116,667,430 (GRCm39) R337* probably null Het
Ndufa4 C T 6: 11,906,092 (GRCm39) V20I probably benign Het
Nf1 A G 11: 79,299,595 (GRCm39) D241G probably null Het
Nid1 A G 13: 13,643,028 (GRCm39) D322G probably benign Het
Nova1 A T 12: 46,747,544 (GRCm39) D244E unknown Het
Or11g27 T A 14: 50,771,770 (GRCm39) D300E probably benign Het
Or4a68 T C 2: 89,269,745 (GRCm39) K293E possibly damaging Het
Or5m10b A G 2: 85,699,350 (GRCm39) K138R probably benign Het
Padi2 C A 4: 140,676,648 (GRCm39) N595K possibly damaging Het
Pag1 A G 3: 9,758,951 (GRCm39) I389T probably damaging Het
Pcdh10 G T 3: 45,335,810 (GRCm39) G708V possibly damaging Het
Pecam1 A G 11: 106,590,610 (GRCm39) S55P probably damaging Het
Plin3 A T 17: 56,591,192 (GRCm39) V196E possibly damaging Het
Plxdc1 A T 11: 97,847,316 (GRCm39) L119Q possibly damaging Het
Pnliprp1 A T 19: 58,726,681 (GRCm39) N346I probably damaging Het
Ppp1r27 A T 11: 120,441,856 (GRCm39) Y8* probably null Het
Prg3 A T 2: 84,819,746 (GRCm39) D80V probably damaging Het
Prmt5 T C 14: 54,745,347 (GRCm39) N607D possibly damaging Het
Ptprs A G 17: 56,730,538 (GRCm39) F1144L probably benign Het
Rai14 C T 15: 10,593,189 (GRCm39) G152R probably damaging Het
Rap1gds1 T A 3: 138,661,976 (GRCm39) R427* probably null Het
Recql5 A G 11: 115,819,248 (GRCm39) V106A probably benign Het
Resp18 T C 1: 75,250,615 (GRCm39) T155A probably benign Het
Rfx6 A G 10: 51,557,914 (GRCm39) D129G probably benign Het
Rsf1 T A 7: 97,310,374 (GRCm39) I368K Het
Sema6a C G 18: 47,424,231 (GRCm39) V226L probably damaging Het
Sf1 A G 19: 6,422,234 (GRCm39) E220G probably damaging Het
Shld2 C T 14: 33,959,423 (GRCm39) S853N probably damaging Het
Sidt1 T A 16: 44,079,848 (GRCm39) Y602F probably damaging Het
Slc17a8 A G 10: 89,428,008 (GRCm39) I273T probably benign Het
Slc28a2b A T 2: 122,353,325 (GRCm39) I502F not run Het
Slc41a1 A T 1: 131,766,889 (GRCm39) I136F probably damaging Het
Snrpb T C 2: 130,018,939 (GRCm39) I51V probably benign Het
Sprr2f T A 3: 92,273,254 (GRCm39) C18S unknown Het
Stab1 T C 14: 30,876,622 (GRCm39) N864S probably benign Het
Svil C A 18: 5,095,188 (GRCm39) T1457K probably benign Het
Syt1 A T 10: 108,340,262 (GRCm39) I352N probably damaging Het
Tas2r119 A G 15: 32,178,279 (GRCm39) K282E probably damaging Het
Timeless T C 10: 128,080,538 (GRCm39) F473S probably damaging Het
Tmc3 A G 7: 83,247,481 (GRCm39) D192G probably damaging Het
Trmt1l T A 1: 151,316,591 (GRCm39) I184N possibly damaging Het
Ttll6 G A 11: 96,025,701 (GRCm39) V61M probably damaging Het
Ttn C T 2: 76,632,755 (GRCm39) E14100K probably damaging Het
Txndc2 T A 17: 65,945,620 (GRCm39) I186F possibly damaging Het
Ubr1 A T 2: 120,703,672 (GRCm39) S1553T possibly damaging Het
Vmn1r208 T C 13: 22,956,705 (GRCm39) N264S probably benign Het
Vmn1r87 T A 7: 12,865,613 (GRCm39) M225L probably benign Het
Vmn2r101 T A 17: 19,831,899 (GRCm39) C632S possibly damaging Het
Wdr97 T A 15: 76,241,949 (GRCm39) Y747* probably null Het
Zfp474 T C 18: 52,772,261 (GRCm39) S305P probably benign Het
Zfp59 A G 7: 27,552,863 (GRCm39) N105S probably benign Het
Zfp804b T A 5: 6,822,301 (GRCm39) Y254F possibly damaging Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R1918:Ccdc148 UTSW 2 58,872,911 (GRCm39) missense probably damaging 1.00
R2114:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7121:Ccdc148 UTSW 2 58,717,579 (GRCm39) missense probably damaging 1.00
R7452:Ccdc148 UTSW 2 58,717,596 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAATGGCGAACAAAACTTTGAAGC -3'
(R):5'- CGACTTGGGAAACAAACCGG -3'

Sequencing Primer
(F):5'- AGGGAAGGTTGTTTAATAAATGCTG -3'
(R):5'- TTGGGAAACAAACCGGAAGGAG -3'
Posted On 2019-10-24