Incidental Mutation 'R7574:Lnx1'
ID586226
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Nameligand of numb-protein X 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7574 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location74592447-74702912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74685438 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 117 (E117G)
Ref Sequence ENSEMBL: ENSMUSP00000113035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087161] [ENSMUST00000117388]
Predicted Effect probably benign
Transcript: ENSMUST00000087161
AA Change: E117G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: E117G

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117388
AA Change: E117G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: E117G

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,942 V240A probably damaging Het
A930009A15Rik C T 10: 115,570,114 probably benign Het
Aarsd1 A G 11: 101,411,144 I201T probably damaging Het
Acaca T A 11: 84,261,588 Y854N probably benign Het
Adra2c T C 5: 35,280,415 L177P probably damaging Het
Akr1c12 A T 13: 4,279,310 I16N probably damaging Het
Aldh8a1 A T 10: 21,380,830 I47F possibly damaging Het
Birc6 A G 17: 74,579,884 I736V probably benign Het
Bmp2 A T 2: 133,560,897 M123L probably benign Het
C1ql1 T C 11: 102,945,986 Y159C probably damaging Het
Ccdc148 T C 2: 58,823,633 Y502C probably damaging Het
Ccdc155 A T 7: 45,204,611 H31Q possibly damaging Het
Cenpf A T 1: 189,658,667 N989K probably damaging Het
Ciz1 A G 2: 32,367,368 M142V probably benign Het
Cnot4 T C 6: 35,053,004 R320G possibly damaging Het
Cyth1 G T 11: 118,182,863 H215N probably damaging Het
Dapk1 G A 13: 60,761,173 G1200D probably damaging Het
Dhps A G 8: 85,072,552 Y103C probably damaging Het
Dnah1 T A 14: 31,319,908 E35D probably benign Het
Dnajb9 A T 12: 44,207,386 D79E probably damaging Het
Eif4a2 T C 16: 23,110,127 F164S probably benign Het
Enpp2 T C 15: 54,851,417 T595A probably benign Het
Exoc6b T A 6: 84,791,384 probably null Het
Fam171a1 T C 2: 3,220,354 S286P probably damaging Het
Fam35a C T 14: 34,237,466 S853N probably damaging Het
Fermt2 T A 14: 45,469,325 N338I probably damaging Het
Fhdc1 A G 3: 84,446,131 F596L probably benign Het
Fry T C 5: 150,380,894 V583A probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdap1 T A 1: 17,161,441 F337I possibly damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm14085 A T 2: 122,522,844 I502F not run Het
Gm35339 T A 15: 76,357,749 Y747* probably null Het
Gm8251 A T 1: 44,059,433 V835E possibly damaging Het
Gpr6 A T 10: 41,070,656 I310N possibly damaging Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Hexa T C 9: 59,563,984 V507A probably benign Het
Hmcn2 A T 2: 31,455,519 H4718L possibly damaging Het
Hrh4 T C 18: 13,021,913 F170L possibly damaging Het
Ica1 T C 6: 8,658,266 T284A probably benign Het
Itga5 T C 15: 103,350,449 N774S probably damaging Het
Itgb2 T C 10: 77,560,158 S556P probably benign Het
Kcnq4 A G 4: 120,711,368 F384L probably benign Het
Lama2 A T 10: 27,006,730 N2612K probably benign Het
Lrrc14b G T 13: 74,360,773 A505E probably damaging Het
Ly6g T C 15: 75,158,564 I77T probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgpre C T 7: 143,781,350 V139M probably damaging Het
Muc4 T A 16: 32,753,411 S1096T probably benign Het
Myrfl G A 10: 116,831,525 R337* probably null Het
Ndufa4 C T 6: 11,906,093 V20I probably benign Het
Nf1 A G 11: 79,408,769 D241G probably null Het
Nid1 A G 13: 13,468,443 D322G probably benign Het
Nova1 A T 12: 46,700,761 D244E unknown Het
Olfr1022 A G 2: 85,869,006 K138R probably benign Het
Olfr1240 T C 2: 89,439,401 K293E possibly damaging Het
Olfr743 T A 14: 50,534,313 D300E probably benign Het
Padi2 C A 4: 140,949,337 N595K possibly damaging Het
Pag1 A G 3: 9,693,891 I389T probably damaging Het
Pcdh10 G T 3: 45,381,375 G708V possibly damaging Het
Pecam1 A G 11: 106,699,784 S55P probably damaging Het
Plin3 A T 17: 56,284,192 V196E possibly damaging Het
Plxdc1 A T 11: 97,956,490 L119Q possibly damaging Het
Pnliprp1 A T 19: 58,738,249 N346I probably damaging Het
Ppp1r27 A T 11: 120,551,030 Y8* probably null Het
Prg3 A T 2: 84,989,402 D80V probably damaging Het
Prmt5 T C 14: 54,507,890 N607D possibly damaging Het
Ptprs A G 17: 56,423,538 F1144L probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rap1gds1 T A 3: 138,956,215 R427* probably null Het
Recql5 A G 11: 115,928,422 V106A probably benign Het
Resp18 T C 1: 75,273,971 T155A probably benign Het
Rfx6 A G 10: 51,681,818 D129G probably benign Het
Rsf1 T A 7: 97,661,167 I368K Het
Sema6a C G 18: 47,291,164 V226L probably damaging Het
Sf1 A G 19: 6,372,204 E220G probably damaging Het
Sidt1 T A 16: 44,259,485 Y602F probably damaging Het
Slc17a8 A G 10: 89,592,146 I273T probably benign Het
Slc41a1 A T 1: 131,839,151 I136F probably damaging Het
Snrpb T C 2: 130,177,019 I51V probably benign Het
Sprr2f T A 3: 92,365,947 C18S unknown Het
Stab1 T C 14: 31,154,665 N864S probably benign Het
Svil C A 18: 5,095,188 T1457K probably benign Het
Syt1 A T 10: 108,504,401 I352N probably damaging Het
Tas2r119 A G 15: 32,178,133 K282E probably damaging Het
Timeless T C 10: 128,244,669 F473S probably damaging Het
Tmc3 A G 7: 83,598,273 D192G probably damaging Het
Trmt1l T A 1: 151,440,840 I184N possibly damaging Het
Ttll6 G A 11: 96,134,875 V61M probably damaging Het
Ttn C T 2: 76,802,411 E14100K probably damaging Het
Txndc2 T A 17: 65,638,625 I186F possibly damaging Het
Ubr1 A T 2: 120,873,191 S1553T possibly damaging Het
Vmn1r208 T C 13: 22,772,535 N264S probably benign Het
Vmn1r87 T A 7: 13,131,686 M225L probably benign Het
Vmn2r101 T A 17: 19,611,637 C632S possibly damaging Het
Zfp474 T C 18: 52,639,189 S305P probably benign Het
Zfp59 A G 7: 27,853,438 N105S probably benign Het
Zfp804b T A 5: 6,772,301 Y254F possibly damaging Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74685717 missense probably benign 0.00
IGL01538:Lnx1 APN 5 74620155 missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74685759 missense probably benign 0.02
IGL03188:Lnx1 APN 5 74620263 missense probably damaging 1.00
bobcat UTSW 5 74685690 missense probably damaging 1.00
Caracal UTSW 5 74606049 missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74620347 critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74607909 splice site probably benign
R1343:Lnx1 UTSW 5 74597379 missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74620017 missense probably damaging 1.00
R1681:Lnx1 UTSW 5 74685410 missense probably benign
R1714:Lnx1 UTSW 5 74607737 missense probably null 1.00
R1727:Lnx1 UTSW 5 74607916 splice site probably null
R1806:Lnx1 UTSW 5 74606049 missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74620066 missense probably benign 0.25
R2879:Lnx1 UTSW 5 74620123 missense probably benign 0.03
R2984:Lnx1 UTSW 5 74685422 nonsense probably null
R3790:Lnx1 UTSW 5 74628366 splice site probably benign
R3953:Lnx1 UTSW 5 74606089 missense probably benign
R4509:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74685543 missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4624:Lnx1 UTSW 5 74660460 intron probably benign
R4647:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4648:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4877:Lnx1 UTSW 5 74628123 missense probably benign 0.01
R4883:Lnx1 UTSW 5 74607869 missense probably benign
R5256:Lnx1 UTSW 5 74685654 missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74677569 missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74685608 nonsense probably null
R6408:Lnx1 UTSW 5 74685646 missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74607880 missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74677514 nonsense probably null
R7511:Lnx1 UTSW 5 74620311 missense probably benign 0.01
R7670:Lnx1 UTSW 5 74685690 missense probably damaging 1.00
R8145:Lnx1 UTSW 5 74685399 missense probably benign 0.22
Z1177:Lnx1 UTSW 5 74627441 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATTGGAACAGATCTCTTCCCTG -3'
(R):5'- AAGCATTGCTGGACCCTCTG -3'

Sequencing Primer
(F):5'- AACAGATCTCTTCCCTGGTGAGAG -3'
(R):5'- ATTGCTGGACCCTCTGGACAC -3'
Posted On2019-10-24