Incidental Mutation 'R7574:Git2'
ID586228
Institutional Source Beutler Lab
Gene Symbol Git2
Ensembl Gene ENSMUSG00000041890
Gene NameG protein-coupled receptor kinase-interactor 2
Synonyms5830420E16Rik, Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 9630056M03Rik, B230104M05Rik, 1500036H07Rik, Cat-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R7574 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114727407-114775517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114766489 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 123 (R123H)
Ref Sequence ENSEMBL: ENSMUSP00000107803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043283] [ENSMUST00000086564] [ENSMUST00000112183] [ENSMUST00000112185] [ENSMUST00000131016] [ENSMUST00000131993] [ENSMUST00000155908] [ENSMUST00000178440]
Predicted Effect probably damaging
Transcript: ENSMUST00000043283
AA Change: R123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039718
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT1_C 550 674 2.4e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086564
AA Change: R123H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083754
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT_CC 414 478 3.7e-31 PFAM
low complexity region 555 570 N/A INTRINSIC
Pfam:GIT1_C 636 752 6.4e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112183
AA Change: R123H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107801
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 268 298 4.96e-10 SMART
GIT 332 362 1.27e-7 SMART
Pfam:GIT1_C 552 676 1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112185
AA Change: R123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107803
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 265 295 4.96e-10 SMART
GIT 329 359 1.27e-7 SMART
low complexity region 504 519 N/A INTRINSIC
Pfam:GIT1_C 579 703 3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131016
AA Change: R118H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116722
Gene: ENSMUSG00000041890
AA Change: R118H

DomainStartEndE-ValueType
ArfGap 9 119 4.52e-41 SMART
ANK 127 156 2.55e2 SMART
ANK 161 190 1.21e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131993
AA Change: R12H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118812
Gene: ENSMUSG00000041890
AA Change: R12H

DomainStartEndE-ValueType
ANK 21 50 2.55e2 SMART
ANK 55 84 1.21e1 SMART
ANK 88 117 3.95e1 SMART
Pfam:GIT_SHD 156 186 7.9e-19 PFAM
Pfam:GIT_SHD 220 249 3.5e-17 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122302
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 96 2.04e-25 SMART
ANK 104 133 2.55e2 SMART
ANK 138 167 1.21e1 SMART
ANK 171 200 3.95e1 SMART
GIT 238 268 4.96e-10 SMART
GIT 302 332 1.27e-7 SMART
Pfam:GIT1_C 474 598 8.3e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178440
AA Change: R123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136796
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 267 297 4.96e-10 SMART
GIT 331 361 1.27e-7 SMART
Pfam:GIT1_C 551 675 2.4e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele show frequent splenomegaly, extramedullary hematopoiesis, impaired neutrophil chemotaxis, misoriented hyperproduction of superoxide anions and increased susceptibility to fungal infection. Homozygotes for a gene trap allele have reduced marginal zone B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,942 V240A probably damaging Het
A930009A15Rik C T 10: 115,570,114 probably benign Het
Aarsd1 A G 11: 101,411,144 I201T probably damaging Het
Acaca T A 11: 84,261,588 Y854N probably benign Het
Adra2c T C 5: 35,280,415 L177P probably damaging Het
Akr1c12 A T 13: 4,279,310 I16N probably damaging Het
Aldh8a1 A T 10: 21,380,830 I47F possibly damaging Het
Birc6 A G 17: 74,579,884 I736V probably benign Het
Bmp2 A T 2: 133,560,897 M123L probably benign Het
C1ql1 T C 11: 102,945,986 Y159C probably damaging Het
Ccdc148 T C 2: 58,823,633 Y502C probably damaging Het
Ccdc155 A T 7: 45,204,611 H31Q possibly damaging Het
Cenpf A T 1: 189,658,667 N989K probably damaging Het
Ciz1 A G 2: 32,367,368 M142V probably benign Het
Cnot4 T C 6: 35,053,004 R320G possibly damaging Het
Cyth1 G T 11: 118,182,863 H215N probably damaging Het
Dapk1 G A 13: 60,761,173 G1200D probably damaging Het
Dhps A G 8: 85,072,552 Y103C probably damaging Het
Dnah1 T A 14: 31,319,908 E35D probably benign Het
Dnajb9 A T 12: 44,207,386 D79E probably damaging Het
Eif4a2 T C 16: 23,110,127 F164S probably benign Het
Enpp2 T C 15: 54,851,417 T595A probably benign Het
Exoc6b T A 6: 84,791,384 probably null Het
Fam171a1 T C 2: 3,220,354 S286P probably damaging Het
Fam35a C T 14: 34,237,466 S853N probably damaging Het
Fermt2 T A 14: 45,469,325 N338I probably damaging Het
Fhdc1 A G 3: 84,446,131 F596L probably benign Het
Fry T C 5: 150,380,894 V583A probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdap1 T A 1: 17,161,441 F337I possibly damaging Het
Gm14085 A T 2: 122,522,844 I502F not run Het
Gm35339 T A 15: 76,357,749 Y747* probably null Het
Gm8251 A T 1: 44,059,433 V835E possibly damaging Het
Gpr6 A T 10: 41,070,656 I310N possibly damaging Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Hexa T C 9: 59,563,984 V507A probably benign Het
Hmcn2 A T 2: 31,455,519 H4718L possibly damaging Het
Hrh4 T C 18: 13,021,913 F170L possibly damaging Het
Ica1 T C 6: 8,658,266 T284A probably benign Het
Itga5 T C 15: 103,350,449 N774S probably damaging Het
Itgb2 T C 10: 77,560,158 S556P probably benign Het
Kcnq4 A G 4: 120,711,368 F384L probably benign Het
Lama2 A T 10: 27,006,730 N2612K probably benign Het
Lnx1 T C 5: 74,685,438 E117G probably benign Het
Lrrc14b G T 13: 74,360,773 A505E probably damaging Het
Ly6g T C 15: 75,158,564 I77T probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgpre C T 7: 143,781,350 V139M probably damaging Het
Muc4 T A 16: 32,753,411 S1096T probably benign Het
Myrfl G A 10: 116,831,525 R337* probably null Het
Ndufa4 C T 6: 11,906,093 V20I probably benign Het
Nf1 A G 11: 79,408,769 D241G probably null Het
Nid1 A G 13: 13,468,443 D322G probably benign Het
Nova1 A T 12: 46,700,761 D244E unknown Het
Olfr1022 A G 2: 85,869,006 K138R probably benign Het
Olfr1240 T C 2: 89,439,401 K293E possibly damaging Het
Olfr743 T A 14: 50,534,313 D300E probably benign Het
Padi2 C A 4: 140,949,337 N595K possibly damaging Het
Pag1 A G 3: 9,693,891 I389T probably damaging Het
Pcdh10 G T 3: 45,381,375 G708V possibly damaging Het
Pecam1 A G 11: 106,699,784 S55P probably damaging Het
Plin3 A T 17: 56,284,192 V196E possibly damaging Het
Plxdc1 A T 11: 97,956,490 L119Q possibly damaging Het
Pnliprp1 A T 19: 58,738,249 N346I probably damaging Het
Ppp1r27 A T 11: 120,551,030 Y8* probably null Het
Prg3 A T 2: 84,989,402 D80V probably damaging Het
Prmt5 T C 14: 54,507,890 N607D possibly damaging Het
Ptprs A G 17: 56,423,538 F1144L probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rap1gds1 T A 3: 138,956,215 R427* probably null Het
Recql5 A G 11: 115,928,422 V106A probably benign Het
Resp18 T C 1: 75,273,971 T155A probably benign Het
Rfx6 A G 10: 51,681,818 D129G probably benign Het
Rsf1 T A 7: 97,661,167 I368K Het
Sema6a C G 18: 47,291,164 V226L probably damaging Het
Sf1 A G 19: 6,372,204 E220G probably damaging Het
Sidt1 T A 16: 44,259,485 Y602F probably damaging Het
Slc17a8 A G 10: 89,592,146 I273T probably benign Het
Slc41a1 A T 1: 131,839,151 I136F probably damaging Het
Snrpb T C 2: 130,177,019 I51V probably benign Het
Sprr2f T A 3: 92,365,947 C18S unknown Het
Stab1 T C 14: 31,154,665 N864S probably benign Het
Svil C A 18: 5,095,188 T1457K probably benign Het
Syt1 A T 10: 108,504,401 I352N probably damaging Het
Tas2r119 A G 15: 32,178,133 K282E probably damaging Het
Timeless T C 10: 128,244,669 F473S probably damaging Het
Tmc3 A G 7: 83,598,273 D192G probably damaging Het
Trmt1l T A 1: 151,440,840 I184N possibly damaging Het
Ttll6 G A 11: 96,134,875 V61M probably damaging Het
Ttn C T 2: 76,802,411 E14100K probably damaging Het
Txndc2 T A 17: 65,638,625 I186F possibly damaging Het
Ubr1 A T 2: 120,873,191 S1553T possibly damaging Het
Vmn1r208 T C 13: 22,772,535 N264S probably benign Het
Vmn1r87 T A 7: 13,131,686 M225L probably benign Het
Vmn2r101 T A 17: 19,611,637 C632S possibly damaging Het
Zfp474 T C 18: 52,639,189 S305P probably benign Het
Zfp59 A G 7: 27,853,438 N105S probably benign Het
Zfp804b T A 5: 6,772,301 Y254F possibly damaging Het
Other mutations in Git2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Git2 APN 5 114767105 missense probably damaging 1.00
IGL02538:Git2 APN 5 114730986 splice site probably benign
IGL03114:Git2 APN 5 114733857 splice site probably benign
IGL03278:Git2 APN 5 114745579 splice site probably benign
IGL03278:Git2 APN 5 114745580 splice site probably null
ponto UTSW 5 114739101 missense probably damaging 1.00
vecchio UTSW 5 114769698 nonsense probably null
R0184:Git2 UTSW 5 114739037 missense possibly damaging 0.47
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0540:Git2 UTSW 5 114748274 missense probably damaging 1.00
R0543:Git2 UTSW 5 114745531 missense probably damaging 0.97
R0612:Git2 UTSW 5 114752281 missense probably damaging 1.00
R1144:Git2 UTSW 5 114753314 missense probably benign 0.27
R1225:Git2 UTSW 5 114733178 splice site probably benign
R1783:Git2 UTSW 5 114739124 missense probably damaging 1.00
R1923:Git2 UTSW 5 114739101 missense probably damaging 1.00
R1956:Git2 UTSW 5 114749337 nonsense probably null
R1981:Git2 UTSW 5 114749559 splice site probably benign
R2029:Git2 UTSW 5 114766450 critical splice donor site probably null
R3150:Git2 UTSW 5 114730349 missense probably damaging 1.00
R4087:Git2 UTSW 5 114764405 missense probably damaging 0.99
R4367:Git2 UTSW 5 114764666 missense probably damaging 1.00
R4400:Git2 UTSW 5 114733909 missense possibly damaging 0.94
R4702:Git2 UTSW 5 114745482 missense probably damaging 1.00
R4758:Git2 UTSW 5 114730351 missense probably damaging 1.00
R4840:Git2 UTSW 5 114745482 missense probably damaging 1.00
R5236:Git2 UTSW 5 114767172 missense probably damaging 1.00
R5427:Git2 UTSW 5 114730328 missense possibly damaging 0.82
R5510:Git2 UTSW 5 114743774 critical splice donor site probably null
R6014:Git2 UTSW 5 114733877 missense probably benign 0.32
R6162:Git2 UTSW 5 114761656 missense probably damaging 0.99
R6195:Git2 UTSW 5 114767114 missense probably benign 0.27
R6198:Git2 UTSW 5 114745495 nonsense probably null
R6233:Git2 UTSW 5 114767114 missense probably benign 0.27
R6277:Git2 UTSW 5 114733247 missense probably damaging 1.00
R6603:Git2 UTSW 5 114730991 critical splice donor site probably null
R7141:Git2 UTSW 5 114769698 nonsense probably null
R7420:Git2 UTSW 5 114730370 missense probably benign 0.00
R7468:Git2 UTSW 5 114733897 missense probably damaging 1.00
R7575:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7577:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7651:Git2 UTSW 5 114733235 missense probably damaging 1.00
R7658:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7893:Git2 UTSW 5 114769676 missense possibly damaging 0.83
R8067:Git2 UTSW 5 114766518 missense probably damaging 0.99
R8415:Git2 UTSW 5 114733928 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCCAGTGTGTCTGAGAGGAG -3'
(R):5'- CCTTTGACTCTGCTGCAGTG -3'

Sequencing Primer
(F):5'- CCAGTGTGTCTGAGAGGAGTGAATG -3'
(R):5'- TTGTTTCCAAACCAGCC -3'
Posted On2019-10-24