Mutagenetix > Incidental Mutations

Incidental Mutation 'R0620:Rasgrf2'

58623

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

038809-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.318) question?

Stock #

R0620 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 91919817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

probably benign
Transcript: ENSMUST00000099326

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151408

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,328,375	Q973L	probably damaging	Het
Adamts9	T	C	6: 92,858,113	T679A	possibly damaging	Het
Ahr	T	C	12: 35,508,194	T276A	probably benign	Het
Akap9	A	T	5: 4,064,136	Q3138H	probably damaging	Het
Armt1	T	A	10: 4,432,689	F7I	probably benign	Het
B3galt2	A	G	1: 143,646,140	R5G	probably damaging	Het
Bod1l	T	C	5: 41,801,233	N2750S	probably benign	Het
Cadps2	T	A	6: 23,583,396	E365V	probably damaging	Het
Cd200r3	T	A	16: 44,957,717		probably null	Het
Cst7	T	A	2: 150,575,886		probably benign	Het
Defb30	A	T	14: 63,049,763		probably benign	Het
Dido1	C	T	2: 180,659,851	G2087S	probably benign	Het
Dio2	A	G	12: 90,738,071	Y72H	probably benign	Het
Dnah11	C	T	12: 117,987,469	E3035K	probably damaging	Het
Dnajb13	T	C	7: 100,503,249	K287E	possibly damaging	Het
Dnajc11	G	A	4: 151,973,628	V244I	possibly damaging	Het
Ect2	C	T	3: 27,139,652	A226T	probably damaging	Het
Ercc8	G	A	13: 108,174,061		probably null	Het
Fam120b	T	A	17: 15,402,927	M389K	probably benign	Het
Fam151a	A	G	4: 106,747,931	M497V	probably benign	Het
Fam186b	C	A	15: 99,280,128	G439V	probably benign	Het
Fank1	A	G	7: 133,876,765	Y185C	probably damaging	Het
Gart	T	C	16: 91,630,602		probably benign	Het
Glb1l	T	C	1: 75,199,720	Y572C	probably damaging	Het
Gm11563	C	T	11: 99,658,437	A164T	unknown	Het
Gnb4	C	T	3: 32,591,207	V112I	probably benign	Het
Gsdmc3	T	A	15: 63,859,693	D330V	probably damaging	Het
H2-DMa	C	T	17: 34,137,960	T144M	probably damaging	Het
Haus6	A	T	4: 86,583,514	F707I	possibly damaging	Het
Hmcn1	T	A	1: 150,594,016	T4971S	probably benign	Het
Ints6	A	T	14: 62,696,759	F766L	probably benign	Het
Kdm5d	T	A	Y: 927,330	M650K	probably damaging	Het
Kif21b	T	C	1: 136,159,428	F881S	possibly damaging	Het
Klrk1	C	A	6: 129,614,635	Q176H	possibly damaging	Het
Ky	T	C	9: 102,537,621	V244A	probably benign	Het
Mia2	T	A	12: 59,154,419	L191M	possibly damaging	Het
Miga2	T	A	2: 30,381,744		probably benign	Het
Mtss1l	C	T	8: 110,737,948	P322S	probably damaging	Het
Nalcn	A	G	14: 123,299,141		probably benign	Het
Ncbp3	T	A	11: 73,049,845		probably benign	Het
Nprl3	G	A	11: 32,234,876	L378F	probably damaging	Het
Ntrk2	A	T	13: 58,846,821	M184L	probably benign	Het
Olfr311	T	G	11: 58,841,443	C110G	probably damaging	Het
Olfr738	G	T	14: 50,413,697	C51F	probably benign	Het
Osbpl9	T	C	4: 109,083,128	E287G	probably damaging	Het
Parva	T	C	7: 112,576,411	F250L	probably damaging	Het
Pcdhb11	C	T	18: 37,421,811	Q65*	probably null	Het
Phtf1	A	G	3: 103,993,765	T377A	probably damaging	Het
Pkp4	G	A	2: 59,322,643	V612I	possibly damaging	Het
Plscr2	C	A	9: 92,287,654	S52R	probably benign	Het
Pnisr	C	T	4: 21,874,092		probably benign	Het
Pole2	A	C	12: 69,209,879	S291A	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,018	F586L	probably benign	Het
Prrx1	G	A	1: 163,257,816	R182C	probably damaging	Het
Ptprs	A	G	17: 56,429,103	I110T	possibly damaging	Het
Riox2	T	C	16: 59,491,892	V464A	probably benign	Het
Robo2	A	G	16: 73,967,802	V646A	possibly damaging	Het
Ros1	T	A	10: 52,118,348	I1279F	probably damaging	Het
Siglec1	G	A	2: 131,074,268	T1254M	probably benign	Het
Snx7	T	C	3: 117,846,675	N62D	probably damaging	Het
Sp100	G	A	1: 85,659,867		probably null	Het
Stil	A	T	4: 115,007,159	I86L	possibly damaging	Het
Tbc1d16	T	A	11: 119,209,038	D170V	probably benign	Het
Tmem2	T	A	19: 21,817,971	S743T	probably benign	Het
Trappc13	G	A	13: 104,161,081	T105M	probably damaging	Het
Trhr	T	A	15: 44,229,500	S378T	probably benign	Het
Ttc7b	T	C	12: 100,500,073		probably null	Het
Vegfc	A	T	8: 54,157,139	Y110F	probably benign	Het
Vmn1r184	C	A	7: 26,267,177	P116H	possibly damaging	Het
Vmn2r5	A	T	3: 64,503,814	C444*	probably null	Het
Zfp341	A	G	2: 154,634,273	E460G	possibly damaging	Het
Zfp819	T	A	7: 43,616,444	V41E	probably benign	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGATGCTCCAGGGCAGTTTCTGAG -3'
(R):5'- TCCATGATGACACTGTGGCAAAGC -3'

Sequencing Primer
(F):5'- AGCTCCAGTCAGACTATCTGC -3'
(R):5'- TGAGTTCCATAACGGGAGTCC -3'

Posted On

2013-07-11