Mutagenetix > Incidental Mutations

Incidental Mutation 'R7574:Rfx6'

586246

Institutional Source

Beutler Lab

Gene Symbol

Rfx6

Ensembl Gene

ENSMUSG00000019900

Gene Name

regulatory factor X, 6

Synonyms

Rfxdc1, 4930572O07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7574 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51677756-51730432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51681818 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 129 (D129G)

Ref Sequence

ENSEMBL: ENSMUSP00000151430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]

Predicted Effect

probably benign
Transcript: ENSMUST00000050455

SMART Domains

Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900

Domain	Start	End	E-Value	Type
Blast:HisKA	91	153	1e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000122922
AA Change: D129G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: D129G

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	120	198	1.9e-33	PFAM
Blast:HisKA	355	417	2e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000219364
AA Change: D129G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,469,942	V240A	probably damaging	Het
A930009A15Rik	C	T	10: 115,570,114		probably benign	Het
Aarsd1	A	G	11: 101,411,144	I201T	probably damaging	Het
Acaca	T	A	11: 84,261,588	Y854N	probably benign	Het
Adra2c	T	C	5: 35,280,415	L177P	probably damaging	Het
Akr1c12	A	T	13: 4,279,310	I16N	probably damaging	Het
Aldh8a1	A	T	10: 21,380,830	I47F	possibly damaging	Het
Birc6	A	G	17: 74,579,884	I736V	probably benign	Het
Bmp2	A	T	2: 133,560,897	M123L	probably benign	Het
C1ql1	T	C	11: 102,945,986	Y159C	probably damaging	Het
Ccdc148	T	C	2: 58,823,633	Y502C	probably damaging	Het
Ccdc155	A	T	7: 45,204,611	H31Q	possibly damaging	Het
Cenpf	A	T	1: 189,658,667	N989K	probably damaging	Het
Ciz1	A	G	2: 32,367,368	M142V	probably benign	Het
Cnot4	T	C	6: 35,053,004	R320G	possibly damaging	Het
Cyth1	G	T	11: 118,182,863	H215N	probably damaging	Het
Dapk1	G	A	13: 60,761,173	G1200D	probably damaging	Het
Dhps	A	G	8: 85,072,552	Y103C	probably damaging	Het
Dnah1	T	A	14: 31,319,908	E35D	probably benign	Het
Dnajb9	A	T	12: 44,207,386	D79E	probably damaging	Het
Eif4a2	T	C	16: 23,110,127	F164S	probably benign	Het
Enpp2	T	C	15: 54,851,417	T595A	probably benign	Het
Exoc6b	T	A	6: 84,791,384		probably null	Het
Fam171a1	T	C	2: 3,220,354	S286P	probably damaging	Het
Fam35a	C	T	14: 34,237,466	S853N	probably damaging	Het
Fermt2	T	A	14: 45,469,325	N338I	probably damaging	Het
Fhdc1	A	G	3: 84,446,131	F596L	probably benign	Het
Fry	T	C	5: 150,380,894	V583A	probably benign	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gdap1	T	A	1: 17,161,441	F337I	possibly damaging	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Gm14085	A	T	2: 122,522,844	I502F	not run	Het
Gm35339	T	A	15: 76,357,749	Y747*	probably null	Het
Gm8251	A	T	1: 44,059,433	V835E	possibly damaging	Het
Gpr6	A	T	10: 41,070,656	I310N	possibly damaging	Het
Gpsm2	G	A	3: 108,700,745	A239V	probably damaging	Het
Hexa	T	C	9: 59,563,984	V507A	probably benign	Het
Hmcn2	A	T	2: 31,455,519	H4718L	possibly damaging	Het
Hrh4	T	C	18: 13,021,913	F170L	possibly damaging	Het
Ica1	T	C	6: 8,658,266	T284A	probably benign	Het
Itga5	T	C	15: 103,350,449	N774S	probably damaging	Het
Itgb2	T	C	10: 77,560,158	S556P	probably benign	Het
Kcnq4	A	G	4: 120,711,368	F384L	probably benign	Het
Lama2	A	T	10: 27,006,730	N2612K	probably benign	Het
Lnx1	T	C	5: 74,685,438	E117G	probably benign	Het
Lrrc14b	G	T	13: 74,360,773	A505E	probably damaging	Het
Ly6g	T	C	15: 75,158,564	I77T	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mrgpre	C	T	7: 143,781,350	V139M	probably damaging	Het
Muc4	T	A	16: 32,753,411	S1096T	probably benign	Het
Myrfl	G	A	10: 116,831,525	R337*	probably null	Het
Ndufa4	C	T	6: 11,906,093	V20I	probably benign	Het
Nf1	A	G	11: 79,408,769	D241G	probably null	Het
Nid1	A	G	13: 13,468,443	D322G	probably benign	Het
Nova1	A	T	12: 46,700,761	D244E	unknown	Het
Olfr1022	A	G	2: 85,869,006	K138R	probably benign	Het
Olfr1240	T	C	2: 89,439,401	K293E	possibly damaging	Het
Olfr743	T	A	14: 50,534,313	D300E	probably benign	Het
Padi2	C	A	4: 140,949,337	N595K	possibly damaging	Het
Pag1	A	G	3: 9,693,891	I389T	probably damaging	Het
Pcdh10	G	T	3: 45,381,375	G708V	possibly damaging	Het
Pecam1	A	G	11: 106,699,784	S55P	probably damaging	Het
Plin3	A	T	17: 56,284,192	V196E	possibly damaging	Het
Plxdc1	A	T	11: 97,956,490	L119Q	possibly damaging	Het
Pnliprp1	A	T	19: 58,738,249	N346I	probably damaging	Het
Ppp1r27	A	T	11: 120,551,030	Y8*	probably null	Het
Prg3	A	T	2: 84,989,402	D80V	probably damaging	Het
Prmt5	T	C	14: 54,507,890	N607D	possibly damaging	Het
Ptprs	A	G	17: 56,423,538	F1144L	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Rap1gds1	T	A	3: 138,956,215	R427*	probably null	Het
Recql5	A	G	11: 115,928,422	V106A	probably benign	Het
Resp18	T	C	1: 75,273,971	T155A	probably benign	Het
Rsf1	T	A	7: 97,661,167	I368K		Het
Sema6a	C	G	18: 47,291,164	V226L	probably damaging	Het
Sf1	A	G	19: 6,372,204	E220G	probably damaging	Het
Sidt1	T	A	16: 44,259,485	Y602F	probably damaging	Het
Slc17a8	A	G	10: 89,592,146	I273T	probably benign	Het
Slc41a1	A	T	1: 131,839,151	I136F	probably damaging	Het
Snrpb	T	C	2: 130,177,019	I51V	probably benign	Het
Sprr2f	T	A	3: 92,365,947	C18S	unknown	Het
Stab1	T	C	14: 31,154,665	N864S	probably benign	Het
Svil	C	A	18: 5,095,188	T1457K	probably benign	Het
Syt1	A	T	10: 108,504,401	I352N	probably damaging	Het
Tas2r119	A	G	15: 32,178,133	K282E	probably damaging	Het
Timeless	T	C	10: 128,244,669	F473S	probably damaging	Het
Tmc3	A	G	7: 83,598,273	D192G	probably damaging	Het
Trmt1l	T	A	1: 151,440,840	I184N	possibly damaging	Het
Ttll6	G	A	11: 96,134,875	V61M	probably damaging	Het
Ttn	C	T	2: 76,802,411	E14100K	probably damaging	Het
Txndc2	T	A	17: 65,638,625	I186F	possibly damaging	Het
Ubr1	A	T	2: 120,873,191	S1553T	possibly damaging	Het
Vmn1r208	T	C	13: 22,772,535	N264S	probably benign	Het
Vmn1r87	T	A	7: 13,131,686	M225L	probably benign	Het
Vmn2r101	T	A	17: 19,611,637	C632S	possibly damaging	Het
Zfp474	T	C	18: 52,639,189	S305P	probably benign	Het
Zfp59	A	G	7: 27,853,438	N105S	probably benign	Het
Zfp804b	T	A	5: 6,772,301	Y254F	possibly damaging	Het

Other mutations in Rfx6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Rfx6	APN	10	51681886	missense	probably damaging	1.00
IGL00816:Rfx6	APN	10	51678405	missense	probably benign	0.16
IGL01639:Rfx6	APN	10	51715906	nonsense	probably null
IGL01721:Rfx6	APN	10	51723077	missense	probably damaging	1.00
IGL01861:Rfx6	APN	10	51721579	missense	probably damaging	1.00
IGL02103:Rfx6	APN	10	51726856	missense	possibly damaging	0.93
IGL02113:Rfx6	APN	10	51678012	missense	probably benign
IGL02479:Rfx6	APN	10	51678328	missense	probably benign	0.07
IGL02592:Rfx6	APN	10	51716023	missense	probably damaging	1.00
IGL02635:Rfx6	APN	10	51716026	missense	possibly damaging	0.80
IGL02891:Rfx6	APN	10	51723846	missense	possibly damaging	0.64
IGL03153:Rfx6	APN	10	51723121	nonsense	probably null
IGL03263:Rfx6	APN	10	51725807	missense	probably benign	0.00
IGL03373:Rfx6	APN	10	51720000	missense	probably damaging	0.99
bulky	UTSW	10	51678333	missense	probably benign	0.00
R0060:Rfx6	UTSW	10	51677840	missense	probably benign	0.00
R0433:Rfx6	UTSW	10	51720028	missense	probably damaging	1.00
R1329:Rfx6	UTSW	10	51693737	missense	probably damaging	1.00
R1709:Rfx6	UTSW	10	51678402	missense	possibly damaging	0.64
R1820:Rfx6	UTSW	10	51723125	critical splice donor site	probably null
R2017:Rfx6	UTSW	10	51721604	missense	possibly damaging	0.50
R2020:Rfx6	UTSW	10	51720057	critical splice donor site	probably null
R2044:Rfx6	UTSW	10	51718126	missense	probably benign	0.16
R2495:Rfx6	UTSW	10	51726675	splice site	probably benign
R2655:Rfx6	UTSW	10	51693777	splice site	probably benign
R2912:Rfx6	UTSW	10	51718130	missense	probably damaging	1.00
R3159:Rfx6	UTSW	10	51726720	missense	probably damaging	1.00
R4036:Rfx6	UTSW	10	51726746	missense	probably damaging	1.00
R4536:Rfx6	UTSW	10	51723784	missense	probably benign	0.16
R4791:Rfx6	UTSW	10	51719944	splice site	probably null
R4945:Rfx6	UTSW	10	51726851	nonsense	probably null
R5223:Rfx6	UTSW	10	51677996	nonsense	probably null
R5233:Rfx6	UTSW	10	51712091	nonsense	probably null
R5448:Rfx6	UTSW	10	51683637	missense	probably damaging	1.00
R5600:Rfx6	UTSW	10	51723061	missense	probably damaging	1.00
R5768:Rfx6	UTSW	10	51726880	missense	probably damaging	0.99
R5858:Rfx6	UTSW	10	51725868	missense	probably benign	0.00
R5949:Rfx6	UTSW	10	51678333	missense	probably benign	0.00
R6001:Rfx6	UTSW	10	51718211	splice site	probably null
R6003:Rfx6	UTSW	10	51708587	missense	probably damaging	1.00
R6118:Rfx6	UTSW	10	51711866	missense	possibly damaging	0.91
R6629:Rfx6	UTSW	10	51725490	missense	probably benign	0.02
R6876:Rfx6	UTSW	10	51719991	missense	probably damaging	1.00
R6894:Rfx6	UTSW	10	51716039	missense	probably damaging	1.00
R6912:Rfx6	UTSW	10	51723853	missense	probably benign	0.00
R7130:Rfx6	UTSW	10	51678380	nonsense	probably null
R7845:Rfx6	UTSW	10	51678026	missense	probably benign	0.05
R8188:Rfx6	UTSW	10	51718196	missense	probably benign	0.05
R8338:Rfx6	UTSW	10	51718094	missense	probably damaging	0.96
V8831:Rfx6	UTSW	10	51718208	critical splice donor site	probably null
X0023:Rfx6	UTSW	10	51678411	missense	probably damaging	1.00
Z1176:Rfx6	UTSW	10	51718093	missense	probably benign	0.05
Z1176:Rfx6	UTSW	10	51725831	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCATCAACAAGAGAATTTCCTTTCC -3'
(R):5'- ACACATGGTCTAACGAATACATGAG -3'

Sequencing Primer
(F):5'- AAAGTCCACTGGCATGTTCTG -3'
(R):5'- TAACGAATACATGAGTTATAAGGCAG -3'

Posted On

2019-10-24