Incidental Mutation 'R7574:Rfx6'
ID586246
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Nameregulatory factor X, 6
SynonymsRfxdc1, 4930572O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7574 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location51677756-51730432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51681818 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 129 (D129G)
Ref Sequence ENSEMBL: ENSMUSP00000151430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
Predicted Effect probably benign
Transcript: ENSMUST00000050455
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122922
AA Change: D129G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: D129G

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000219364
AA Change: D129G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,942 V240A probably damaging Het
A930009A15Rik C T 10: 115,570,114 probably benign Het
Aarsd1 A G 11: 101,411,144 I201T probably damaging Het
Acaca T A 11: 84,261,588 Y854N probably benign Het
Adra2c T C 5: 35,280,415 L177P probably damaging Het
Akr1c12 A T 13: 4,279,310 I16N probably damaging Het
Aldh8a1 A T 10: 21,380,830 I47F possibly damaging Het
Birc6 A G 17: 74,579,884 I736V probably benign Het
Bmp2 A T 2: 133,560,897 M123L probably benign Het
C1ql1 T C 11: 102,945,986 Y159C probably damaging Het
Ccdc148 T C 2: 58,823,633 Y502C probably damaging Het
Ccdc155 A T 7: 45,204,611 H31Q possibly damaging Het
Cenpf A T 1: 189,658,667 N989K probably damaging Het
Ciz1 A G 2: 32,367,368 M142V probably benign Het
Cnot4 T C 6: 35,053,004 R320G possibly damaging Het
Cyth1 G T 11: 118,182,863 H215N probably damaging Het
Dapk1 G A 13: 60,761,173 G1200D probably damaging Het
Dhps A G 8: 85,072,552 Y103C probably damaging Het
Dnah1 T A 14: 31,319,908 E35D probably benign Het
Dnajb9 A T 12: 44,207,386 D79E probably damaging Het
Eif4a2 T C 16: 23,110,127 F164S probably benign Het
Enpp2 T C 15: 54,851,417 T595A probably benign Het
Exoc6b T A 6: 84,791,384 probably null Het
Fam171a1 T C 2: 3,220,354 S286P probably damaging Het
Fam35a C T 14: 34,237,466 S853N probably damaging Het
Fermt2 T A 14: 45,469,325 N338I probably damaging Het
Fhdc1 A G 3: 84,446,131 F596L probably benign Het
Fry T C 5: 150,380,894 V583A probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdap1 T A 1: 17,161,441 F337I possibly damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm14085 A T 2: 122,522,844 I502F not run Het
Gm35339 T A 15: 76,357,749 Y747* probably null Het
Gm8251 A T 1: 44,059,433 V835E possibly damaging Het
Gpr6 A T 10: 41,070,656 I310N possibly damaging Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Hexa T C 9: 59,563,984 V507A probably benign Het
Hmcn2 A T 2: 31,455,519 H4718L possibly damaging Het
Hrh4 T C 18: 13,021,913 F170L possibly damaging Het
Ica1 T C 6: 8,658,266 T284A probably benign Het
Itga5 T C 15: 103,350,449 N774S probably damaging Het
Itgb2 T C 10: 77,560,158 S556P probably benign Het
Kcnq4 A G 4: 120,711,368 F384L probably benign Het
Lama2 A T 10: 27,006,730 N2612K probably benign Het
Lnx1 T C 5: 74,685,438 E117G probably benign Het
Lrrc14b G T 13: 74,360,773 A505E probably damaging Het
Ly6g T C 15: 75,158,564 I77T probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgpre C T 7: 143,781,350 V139M probably damaging Het
Muc4 T A 16: 32,753,411 S1096T probably benign Het
Myrfl G A 10: 116,831,525 R337* probably null Het
Ndufa4 C T 6: 11,906,093 V20I probably benign Het
Nf1 A G 11: 79,408,769 D241G probably null Het
Nid1 A G 13: 13,468,443 D322G probably benign Het
Nova1 A T 12: 46,700,761 D244E unknown Het
Olfr1022 A G 2: 85,869,006 K138R probably benign Het
Olfr1240 T C 2: 89,439,401 K293E possibly damaging Het
Olfr743 T A 14: 50,534,313 D300E probably benign Het
Padi2 C A 4: 140,949,337 N595K possibly damaging Het
Pag1 A G 3: 9,693,891 I389T probably damaging Het
Pcdh10 G T 3: 45,381,375 G708V possibly damaging Het
Pecam1 A G 11: 106,699,784 S55P probably damaging Het
Plin3 A T 17: 56,284,192 V196E possibly damaging Het
Plxdc1 A T 11: 97,956,490 L119Q possibly damaging Het
Pnliprp1 A T 19: 58,738,249 N346I probably damaging Het
Ppp1r27 A T 11: 120,551,030 Y8* probably null Het
Prg3 A T 2: 84,989,402 D80V probably damaging Het
Prmt5 T C 14: 54,507,890 N607D possibly damaging Het
Ptprs A G 17: 56,423,538 F1144L probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rap1gds1 T A 3: 138,956,215 R427* probably null Het
Recql5 A G 11: 115,928,422 V106A probably benign Het
Resp18 T C 1: 75,273,971 T155A probably benign Het
Rsf1 T A 7: 97,661,167 I368K Het
Sema6a C G 18: 47,291,164 V226L probably damaging Het
Sf1 A G 19: 6,372,204 E220G probably damaging Het
Sidt1 T A 16: 44,259,485 Y602F probably damaging Het
Slc17a8 A G 10: 89,592,146 I273T probably benign Het
Slc41a1 A T 1: 131,839,151 I136F probably damaging Het
Snrpb T C 2: 130,177,019 I51V probably benign Het
Sprr2f T A 3: 92,365,947 C18S unknown Het
Stab1 T C 14: 31,154,665 N864S probably benign Het
Svil C A 18: 5,095,188 T1457K probably benign Het
Syt1 A T 10: 108,504,401 I352N probably damaging Het
Tas2r119 A G 15: 32,178,133 K282E probably damaging Het
Timeless T C 10: 128,244,669 F473S probably damaging Het
Tmc3 A G 7: 83,598,273 D192G probably damaging Het
Trmt1l T A 1: 151,440,840 I184N possibly damaging Het
Ttll6 G A 11: 96,134,875 V61M probably damaging Het
Ttn C T 2: 76,802,411 E14100K probably damaging Het
Txndc2 T A 17: 65,638,625 I186F possibly damaging Het
Ubr1 A T 2: 120,873,191 S1553T possibly damaging Het
Vmn1r208 T C 13: 22,772,535 N264S probably benign Het
Vmn1r87 T A 7: 13,131,686 M225L probably benign Het
Vmn2r101 T A 17: 19,611,637 C632S possibly damaging Het
Zfp474 T C 18: 52,639,189 S305P probably benign Het
Zfp59 A G 7: 27,853,438 N105S probably benign Het
Zfp804b T A 5: 6,772,301 Y254F possibly damaging Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51681886 missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51678405 missense probably benign 0.16
IGL01639:Rfx6 APN 10 51715906 nonsense probably null
IGL01721:Rfx6 APN 10 51723077 missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51721579 missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51726856 missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51678012 missense probably benign
IGL02479:Rfx6 APN 10 51678328 missense probably benign 0.07
IGL02592:Rfx6 APN 10 51716023 missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51716026 missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51723846 missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51723121 nonsense probably null
IGL03263:Rfx6 APN 10 51725807 missense probably benign 0.00
IGL03373:Rfx6 APN 10 51720000 missense probably damaging 0.99
bulky UTSW 10 51678333 missense probably benign 0.00
R0060:Rfx6 UTSW 10 51677840 missense probably benign 0.00
R0433:Rfx6 UTSW 10 51720028 missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51693737 missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51678402 missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51723125 critical splice donor site probably null
R2017:Rfx6 UTSW 10 51721604 missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51720057 critical splice donor site probably null
R2044:Rfx6 UTSW 10 51718126 missense probably benign 0.16
R2495:Rfx6 UTSW 10 51726675 splice site probably benign
R2655:Rfx6 UTSW 10 51693777 splice site probably benign
R2912:Rfx6 UTSW 10 51718130 missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51726720 missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51726746 missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51723784 missense probably benign 0.16
R4791:Rfx6 UTSW 10 51719944 splice site probably null
R4945:Rfx6 UTSW 10 51726851 nonsense probably null
R5223:Rfx6 UTSW 10 51677996 nonsense probably null
R5233:Rfx6 UTSW 10 51712091 nonsense probably null
R5448:Rfx6 UTSW 10 51683637 missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51723061 missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51726880 missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51725868 missense probably benign 0.00
R5949:Rfx6 UTSW 10 51678333 missense probably benign 0.00
R6001:Rfx6 UTSW 10 51718211 splice site probably null
R6003:Rfx6 UTSW 10 51708587 missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51711866 missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51725490 missense probably benign 0.02
R6876:Rfx6 UTSW 10 51719991 missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51716039 missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51723853 missense probably benign 0.00
R7130:Rfx6 UTSW 10 51678380 nonsense probably null
R7845:Rfx6 UTSW 10 51678026 missense probably benign 0.05
R8188:Rfx6 UTSW 10 51718196 missense probably benign 0.05
R8338:Rfx6 UTSW 10 51718094 missense probably damaging 0.96
V8831:Rfx6 UTSW 10 51718208 critical splice donor site probably null
X0023:Rfx6 UTSW 10 51678411 missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51718093 missense probably benign 0.05
Z1176:Rfx6 UTSW 10 51725831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATCAACAAGAGAATTTCCTTTCC -3'
(R):5'- ACACATGGTCTAACGAATACATGAG -3'

Sequencing Primer
(F):5'- AAAGTCCACTGGCATGTTCTG -3'
(R):5'- TAACGAATACATGAGTTATAAGGCAG -3'
Posted On2019-10-24