Incidental Mutation 'R0620:Ercc8'
ID 58625
Institutional Source Beutler Lab
Gene Symbol Ercc8
Ensembl Gene ENSMUSG00000021694
Gene Name excision repaiross-complementing rodent repair deficiency, complementation group 8
Synonyms 2810431L23Rik, 4631412O06Rik, B130065P18Rik, 2410022P04Rik, Csa, Ckn1
MMRRC Submission 038809-MU
Accession Numbers

Genbank: NM_028042

Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R0620 (G1)
Quality Score 191
Status Validated
Chromosome 13
Chromosomal Location 108158731-108195364 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 108174061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054835] [ENSMUST00000120672] [ENSMUST00000123182] [ENSMUST00000123657] [ENSMUST00000129117] [ENSMUST00000133957] [ENSMUST00000142931] [ENSMUST00000152634]
AlphaFold Q8CFD5
Predicted Effect probably null
Transcript: ENSMUST00000054835
SMART Domains Protein: ENSMUSP00000059211
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
WD40 175 215 2.71e-10 SMART
WD40 234 273 9.24e-4 SMART
WD40 323 362 7.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120672
AA Change: G184D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112746
Gene: ENSMUSG00000021694
AA Change: G184D

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Blast:WD40 137 172 6e-6 BLAST
low complexity region 186 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123138
SMART Domains Protein: ENSMUSP00000119212
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 2 54 4e-29 PDB
Blast:WD40 28 54 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123182
SMART Domains Protein: ENSMUSP00000121777
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123657
SMART Domains Protein: ENSMUSP00000117492
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129117
SMART Domains Protein: ENSMUSP00000116507
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133957
SMART Domains Protein: ENSMUSP00000116226
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 54 3e-30 PDB
Blast:WD40 28 54 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142931
SMART Domains Protein: ENSMUSP00000118154
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152634
SMART Domains Protein: ENSMUSP00000122802
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutation of this gene results in skin photosensitivity, increased incidence of skin tumors after UV exposure, and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Ercc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Ercc8 APN 13 108169459 missense probably damaging 1.00
IGL02074:Ercc8 APN 13 108158784 unclassified probably benign
B5639:Ercc8 UTSW 13 108160723 missense probably damaging 0.96
R1909:Ercc8 UTSW 13 108175566 nonsense probably null
R2509:Ercc8 UTSW 13 108183717 splice site probably benign
R2967:Ercc8 UTSW 13 108160714 missense probably damaging 1.00
R3857:Ercc8 UTSW 13 108194114 missense possibly damaging 0.82
R4941:Ercc8 UTSW 13 108160767 unclassified probably benign
R5585:Ercc8 UTSW 13 108175589 missense probably damaging 0.99
R6023:Ercc8 UTSW 13 108178577 missense probably damaging 1.00
R6363:Ercc8 UTSW 13 108183870 missense probably damaging 1.00
R6483:Ercc8 UTSW 13 108183810 missense probably damaging 0.99
R6825:Ercc8 UTSW 13 108158809 missense probably damaging 0.97
R7151:Ercc8 UTSW 13 108187282 critical splice donor site probably null
R7166:Ercc8 UTSW 13 108169433 missense possibly damaging 0.94
R7710:Ercc8 UTSW 13 108183863 missense probably benign
R8395:Ercc8 UTSW 13 108187254 nonsense probably null
R8678:Ercc8 UTSW 13 108169493 critical splice donor site probably null
R8744:Ercc8 UTSW 13 108183773 missense probably benign
R9026:Ercc8 UTSW 13 108183855 missense possibly damaging 0.51
R9191:Ercc8 UTSW 13 108169380 missense probably benign 0.05
R9281:Ercc8 UTSW 13 108183830 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGTGCAGACACAGGTCCATGTCTC -3'
(R):5'- TGGTTTTCATGTAGAAACAGCCGGG -3'

Sequencing Primer
(F):5'- TCTCGGCCATAGCCAGTAGAG -3'
(R):5'- AGTCTCAACAGCGCAGTTTTAC -3'
Posted On 2013-07-11