Incidental Mutation 'R7574:Nf1'

• ID: 586253
• Institutional Source: Beutler Lab
• Gene Symbol: Nf1
• Ensembl Gene: ENSMUSG00000020716
• Gene Name: neurofibromin 1
• Synonyms: Nf-1, neurofibromin
• MMRRC Submission: 045660-MU
• Accession Numbers:

  Genbank: NM_010897; MGI: 97306

• Essential gene?: Essential (E-score: 1.000)
• Stock #: R7574 (G1)
• Quality Score: 225.009
• Status: Not validated
• Chromosome: 11
• Chromosomal Location: 79339693-79581612 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 79408769 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Aspartic acid to Glycine at position 241 (D241G)
• Ref Sequence: ENSEMBL: ENSMUSP00000071289
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
• AlphaFold: no structure available at present
• Predicted Effect: probably null; Transcript: ENSMUST00000071325; AA Change: D241G; PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
• SMART Domains: Protein: ENSMUSP00000071289; Gene: ENSMUSG00000020716; AA Change: D241G

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

• Predicted Effect: probably null; Transcript: ENSMUST00000108251; AA Change: D241G; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
• SMART Domains: Protein: ENSMUSP00000103886; Gene: ENSMUSG00000020716; AA Change: D241G

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

• Predicted Effect: probably null; Transcript: ENSMUST00000219057; AA Change: D241G; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
• Allele List at MGI:

  All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

• Posted On: 2019-10-24

Predicted Primers

PCR Primer
(F):5'- CTTCCTCTTAATGGGAAGAATGC -3'
(R):5'- ACCACTTGCTCAGAAGGGAAAG -3'

Sequencing Primer
(F):5'- TCCTCTTAATGGGAAGAATGCAACAC -3'
(R):5'- CTTGCTCAGAAGGGAAAGGACTG -3'