Incidental Mutation 'R0620:Olfr738'
ID 58626
Institutional Source Beutler Lab
Gene Symbol Olfr738
Ensembl Gene ENSMUSG00000094692
Gene Name olfactory receptor 738
Synonyms GA_x6K02T2PMLR-6110726-6111661, MOR106-3
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 50407568-50415438 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 50413697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 51 (C51F)
Ref Sequence ENSEMBL: ENSMUSP00000150351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058972] [ENSMUST00000214320] [ENSMUST00000214853] [ENSMUST00000216949]
AlphaFold L7N1X7
Predicted Effect probably benign
Transcript: ENSMUST00000058972
AA Change: C51F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059540
Gene: ENSMUSG00000094692
AA Change: C51F

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.5e-50 PFAM
Pfam:7TM_GPCR_Srsx 39 309 1.3e-5 PFAM
Pfam:7tm_1 45 294 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205382
Predicted Effect probably benign
Transcript: ENSMUST00000214320
AA Change: C51F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214853
AA Change: C51F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216949
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ect2 C T 3: 27,139,652 A226T probably damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Olfr738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Olfr738 APN 14 50414453 missense probably benign
IGL01935:Olfr738 APN 14 50413555 missense probably benign
IGL02431:Olfr738 APN 14 50413769 missense probably damaging 1.00
BB008:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
BB018:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
PIT4480001:Olfr738 UTSW 14 50413915 missense probably benign 0.14
R1445:Olfr738 UTSW 14 50414401 missense probably damaging 1.00
R1831:Olfr738 UTSW 14 50414201 splice site probably null
R1915:Olfr738 UTSW 14 50414341 missense probably damaging 1.00
R4748:Olfr738 UTSW 14 50413876 missense possibly damaging 0.77
R5301:Olfr738 UTSW 14 50413573 missense probably benign 0.09
R5767:Olfr738 UTSW 14 50413778 missense possibly damaging 0.55
R5831:Olfr738 UTSW 14 50413982 splice site probably null
R6173:Olfr738 UTSW 14 50414197 missense possibly damaging 0.70
R6176:Olfr738 UTSW 14 50414390 missense probably damaging 1.00
R7356:Olfr738 UTSW 14 50413702 missense probably damaging 1.00
R7678:Olfr738 UTSW 14 50414014 missense probably damaging 0.98
R7931:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
R8508:Olfr738 UTSW 14 50413675 missense probably benign 0.00
R8696:Olfr738 UTSW 14 50413963 missense possibly damaging 0.95
R9374:Olfr738 UTSW 14 50414168 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACAGATGAAAGCCTTTAGCAGCCC -3'
(R):5'- TGAGCACAGCCCTCATTACTAGAGC -3'

Sequencing Primer
(F):5'- TTTAGCAGCCCCAGCAACTC -3'
(R):5'- GGTATCGATCAAATGCCATGACTG -3'
Posted On 2013-07-11